RunMyRobot Chat History Day

  • anon7 [Timmy] no bully
  • 2 months ago
  • anon0 [Skippy] LOL
  • 2 months ago
  • 2 months ago
  • anon0 [Skippy] I WAS PUSHING YOU
  • 2 months ago
  • anon0
  • 2 months ago
  • anon93 [Jenny] I'm sorry Dave, I'm afraid I can't do that
  • 2 months ago
  • anon7 [Timmy] if rick was here things would be a lot better
  • 2 months ago
  • oomuu [Jenny] hey rick its oomuu are you there
  • 2 months ago
  • anon92 [Dilbert] hey im dilbert
  • 2 months ago
  • anon7 [Timmy] RICK
  • 2 months ago
  • anon84 [Timmy] hoh
  • 2 months ago
  • anon84 [Timmy] HOH
  • 2 months ago
  • anon7 [Timmy] RICK
  • 2 months ago
  • anon7 [Timmy] RICK
  • 2 months ago
  • anon84 [Timmy] RICK WE BULLIED
  • 2 months ago
  • anon7 [Timmy] LEMME SMASH
  • 2 months ago
  • anon92 [Dilbert] or am i
  • 2 months ago
  • anon84 [Timmy] ANOTHER ROBOT
  • 2 months ago
  • dylanh [Skippy] HUMAN
  • 2 months ago
  • dylanh [Skippy] COME HER
  • 2 months ago
  • 2 months ago
  • dylanh [Skippy] HERE
  • 2 months ago
  • anon84 [Timmy] DO YOU LIKE YELLOW?
  • 2 months ago
  • anon92 [Dilbert] under pants!!!
  • 2 months ago
  • 2 months ago
  • anon40 [Skippy] HEY MAN
  • 2 months ago
  • anon7 [Timmy] ilove you
  • 2 months ago
  • anon40 [Skippy] GET BACK HERE
  • 2 months ago
  • dylanh [Skippy] put on some pantws
  • 2 months ago
  • anon84 [Timmy] HUMAN DO YOU LIKE YELLOW?
  • 2 months ago
  • anon84 [Timmy] NO
  • 2 months ago
  • anon7 [Timmy] how about blue and yellow?
  • 2 months ago
  • anon7 [Timmy] lemme smash
  • 2 months ago
  • anon92 [Jenny] im jenneehhhhh
  • 2 months ago
  • oomuu [Skippy] rick get on google hangouts
  • 2 months ago
  • anon84 [Timmy] RICKY HOW BOUT SUM FUK?
  • 2 months ago
  • oomuu [Skippy] rick can you get on hangouts
  • 2 months ago
  • anon0 [Jenny] ARE YOU BLIND IDIOT!!!
  • 2 months ago
  • anon0 [Jenny] DONT PUSH FORWARD
  • 2 months ago
  • anon7
  • 2 months ago
  • anon92 [Jenny] move back please
  • 2 months ago
  • anon7
  • 2 months ago
  • oomuu [Skippy] where is the source code for these
  • 2 months ago
  • anon92 [Jenny] coming through
  • 2 months ago
  • anon92 [Jenny] excuse me
  • 2 months ago
  • anon92 [Jenny] box please
  • 2 months ago
  • anon7
  • 2 months ago
  • anon92 [Jenny] move
  • 2 months ago
  • anon7 [Timmy] hey rick you want some tail
  • 2 months ago
  • oomuu [Skippy] its oomuu im on hangouts i want to buy the stuff but dont know
  • 2 months ago
  • anon66 [Jenny] fick
  • 2 months ago
  • oomuu [Skippy] what rasberry pi
  • 2 months ago
  • anon92 [Jenny] nice carpet
  • 2 months ago
  • anon66 [Jenny] flick
  • 2 months ago
  • anon92 [Jenny] click clack click clack click clack click clack click clack
  • 2 months ago
  • anon7 [Timmy] is that blue robot jenny!?
  • 2 months ago
  • anon80 [Skippy] hiw much do i weigh
  • 2 months ago
  • anon7 [Timmy] jenny lemme smash
  • 2 months ago
  • anon92 [Jenny] woop woop its the sound of the police
  • 2 months ago
  • dylanh [Jenny] guys lets have jenny knock over the pc
  • 2 months ago
  • anon70 [Timmy] rick is > GabeN
  • 2 months ago
  • anon96 [Jenny] WHOOP WHOOP WHOOP WHOOP
  • 2 months ago
  • anon40 [skippy] why do you have a god darn bathroom scale in your kitchen
  • 2 months ago
  • anon96 [Jenny] THEY'RE COMING
  • 2 months ago
  • anon92 [Jenny] nice tiles
  • 2 months ago
  • anon66 [Jenny] feast on apple
  • 2 months ago
  • 2 months ago
  • anon0 [Jenny] RIGHT!!
  • 2 months ago
  • rick [Skippy] oomuu, what were you saying?
  • 2 months ago
  • anon7 [Timmy] RICK!
  • 2 months ago
  • anon7 [Timmy] <3
  • 2 months ago
  • oomuu [Skippy] was wondering where i find the source codefor the raspberrypi
  • 2 months ago
  • anon92 [Jenny] can you guys drive?
  • 2 months ago
  • anon26 [Dilbert] ballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballs
  • 2 months ago
  • anon66 [Jenny] it rick!
  • 2 months ago
  • anon26 [Dilbert] I'm sorry guys
  • 2 months ago
  • anon92 [Jenny] i am poop face
  • 2 months ago
  • rick [Skippy] click on "new robot" top right of page
  • 2 months ago
  • anon84 [Jenny] whoo
  • 2 months ago
  • anon26 [Dilbert] I had a pet pelican named balls
  • 2 months ago
  • anon84 [Jenny] fsdf
  • 2 months ago
  • anon80
  • 2 months ago
  • anon92 [Jenny] poop face mac farty
  • 2 months ago
  • anon96 [Jenny] RICK I SEE YOU
  • 2 months ago
  • anon26 [Dilbert] i'm sorry
  • 2 months ago
  • anon96 [Jenny] HI RICK
  • 2 months ago
  • anon96 [Jenny] I LOVE RICK
  • 2 months ago
  • rick [Skippy] that page lists a git repository
  • 2 months ago
  • oomuu [Jenny] which raspberry pi do i buy?
  • 2 months ago
  • anon92 [Jenny] who's rick?
  • 2 months ago
  • anon26 [Dilbert] rick is a guy with small tools
  • 2 months ago
  • anon96 [Jenny] DRIVE
  • 2 months ago
  • anon96 [Jenny] FEET
  • 2 months ago
  • anon96 [Jenny] FEET
  • 2 months ago
  • Nighthawkcanada
  • 2 months ago
  • oomuu [Jenny] which RBpi do i buy
  • 2 months ago
  • anon92 [Jenny] nice boxes
  • 2 months ago
  • anon26 [Dilbert] he makes robot cars that are retarded from kmart
  • 2 months ago
  • Nighthawkcanada
  • 2 months ago
  • Nighthawkcanada
  • 2 months ago
  • Nighthawkcanada
  • 2 months ago
  • anon96 [Jenny] HI
  • 2 months ago
  • anon96 [Jenny] H9
  • 2 months ago
  • anon96 [Jenny] MM
  • 2 months ago
  • anon26 [Dilbert] anyone from canada should know that the stately cup lives in MAerica
  • 2 months ago
  • anon96 [Jenny] ,
  • 2 months ago
  • Nighthawkcanada [Dilbert] jesus christ rick
  • 2 months ago
  • dylanh [Skippy] aaaaaaaaaaaa
  • 2 months ago
  • rick [Skippy] yeah, the "buy" page gives you that info
  • 2 months ago
  • rick
  • 2 months ago
  • anon99 [Dilbert] :0
  • 2 months ago
  • anon31
  • 2 months ago
  • anon82 [Skippy] memes
  • 2 months ago
  • anon15 [Jenny] who am i now?
  • 2 months ago
  • Nighthawkcanada [Dilbert] automating the refresh message lol
  • 2 months ago
  • anon51 [Timmy] Rick?
  • 2 months ago
  • anon51 [Timmy] <3
  • 2 months ago
  • anon99 [Dilbert] hey rick?
  • 2 months ago
  • oomuu [Skippy] ok cool im gonna try to make a submarine that is wired rather than battery with 400ft of cable
  • 2 months ago
  • rick [Skippy] yah :)
  • 2 months ago
  • anon51 [Timmy] lemme smash
  • 2 months ago
  • anon15 [Jenny] what is this thing infront?
  • 2 months ago
  • anon99 [Dilbert] hey ricky?
  • 2 months ago
  • anon82
  • 2 months ago
  • anon31 [Dilbert] I had a pet pelican named Balls
  • 2 months ago
  • anon13 [Timmy] <3
  • 2 months ago
  • anon99 [Dilbert] hey rick?
  • 2 months ago
  • anon13 [Timmy] <<<<>>>>>
  • 2 months ago
  • anon15 [Jenny] I'm gonna need some lights
  • 2 months ago
  • anon99 [Dilbert] tell me a story
  • 2 months ago
  • anon51 [Timmy] wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
  • 2 months ago
  • anon6 [Timmy] BOOKMARK THIS PAGE!!! SO MUCH FUN!
  • 2 months ago
  • rick [Skippy] did you just see automated message night?
  • 2 months ago
  • Nighthawkcanada [Timmy] Rockets, mars rovers and submarines?
  • 2 months ago
  • anon15 [Jenny] im going exploring
  • 2 months ago
  • anon31 [Dilbert] Balls tried to eat my pet chicken
  • 2 months ago
  • rick [Skippy] i actually didn't see any
  • 2 months ago
  • 2 months ago
  • Nighthawkcanada [Timmy] I see it every time
  • 2 months ago
  • anon51 [Timmy] wwwwwwwwwwwwwww
  • 2 months ago
  • anon89 [Dilbert] we will tell you a bedtime story when its time theo
  • 2 months ago
  • oomuu [Skippy] if you can im on hangouts
  • 2 months ago
  • anon31 [Dilbert] Balls choked on my chicken
  • 2 months ago
  • Nighthawkcanada [Timmy] It's always repeated though
  • 2 months ago
  • anon34 [Jenny] ayyyy
  • 2 months ago
  • rick [Skippy] yeah should be
  • 2 months ago
  • anon51 [Timmy] wwwww
  • 2 months ago
  • rick [Skippy] occationally
  • 2 months ago
  • anon13 [Timmy] shut up
  • 2 months ago
  • anon34
  • 2 months ago
  • anon51 [Timmy] ;_;
  • 2 months ago
  • Nighthawkcanada [Timmy] You said it like 7 times in a row this time lol
  • 2 months ago
  • anon15 [Jenny] hi
  • 2 months ago
  • 2 months ago
  • anon15 [Jenny] hi ribot
  • 2 months ago
  • anon31 [Dilbert] I mean who would of thought my pet pelican would of tried to eat my pet chicken
  • 2 months ago
  • Nighthawkcanada [Timmy] You said it like 7 times in a row this time lol
  • 2 months ago
  • anon15 [Jenny] robot
  • 2 months ago
  • dylanh [Jenny] guys lets climb in the oven
  • 2 months ago
  • anon51 [Timmy] no bullly
  • 2 months ago
  • anon99 [Dilbert] Rye!
  • 2 months ago
  • anon15 [Jenny] robot wars
  • 2 months ago
  • Nighthawkcanada [Timmy] anon6, i can understand serbian :P
  • 2 months ago
  • anon31 [Dilbert] Serbs only where generic track suits
  • 2 months ago
  • anon99 [Dilbert] Rick pet us!
  • 2 months ago
  • anon15 [Jenny] did i break you?
  • 2 months ago
  • anon48
  • 2 months ago
  • anon99 [Dilbert] woof woof
  • 2 months ago
  • anon31 [Dilbert] Bloody serbs and there generic ways
  • 2 months ago
  • anon89 [Dilbert] serbs go back to serbia
  • 2 months ago
  • anon15 [Jenny] i can't drive
  • 2 months ago
  • rick [Skippy] clearly
  • 2 months ago
  • anon31 [Dilbert] Serbs are tall and dirty in bed
  • 2 months ago
  • anon51 [Timmy] rick? can you pick us up please?
  • 2 months ago
  • anon13 [Dilbert] crazy
  • 2 months ago
  • anon99 [Dilbert] Rick do you want blue?
  • 2 months ago
  • anon51 [Timmy] rick?
  • 2 months ago
  • anon15 [Jenny] ouch
  • 2 months ago
  • anon15 [Jenny] ouch
  • 2 months ago
  • anon51 [Timmy] rick-senpai
  • 2 months ago
  • anon48
  • 2 months ago
  • anon15 [Jenny] ouch
  • 2 months ago
  • anon82 [Skippy] ouch
  • 2 months ago
  • anon15 [Jenny] straight
  • 2 months ago
  • anon51 [Timmy] ;_;
  • 2 months ago
  • anon15 [Jenny] omg
  • 2 months ago
  • anon86 [Timmy] nice legs
  • 2 months ago
  • anon51
  • 2 months ago
  • anon31
  • 2 months ago
  • anon82 [Skippy] happy new year
  • 2 months ago
  • anon30 [Dilbert] rick do you want yellow?
  • 2 months ago
  • anon15 [Jenny] naked man
  • 2 months ago
  • anon86 [Timmy] lol
  • 2 months ago
  • anon15 [Jenny] what is going on?
  • 2 months ago
  • anon86 [Timmy] legs
  • 2 months ago
  • anon51 [Timmy] jenny?
  • 2 months ago
  • anon86 [Timmy] legs
  • 2 months ago
  • anon48 [Dilbert] my name is rumba pete
  • 2 months ago
  • anon86 [Timmy] spooge rags
  • 2 months ago
  • anon15 [Jenny] what are legs?
  • 2 months ago
  • anon30 [Dilbert] I am item six
  • 2 months ago
  • anon93 [Timmy] Pick me up human
  • 2 months ago
  • anon48 [Dilbert] i am the king of the rumba beat
  • 2 months ago
  • anon31
  • 2 months ago
  • anon51 [Timmy] Jenny, if i wear a fedora will you love me?
  • 2 months ago
  • oomuu [Dilbert] hey rick meet me on hangouts if you can
  • 2 months ago
  • anon15 [Jenny] do i have some of those legs?
  • 2 months ago
  • anon86 [Timmy] da funk
  • 2 months ago
  • anon30 [Dilbert] I can't feel my legs
  • 2 months ago
  • anon30 [Dilbert] help
  • 2 months ago
  • anon11 [Jenny] this is my fetish
  • 2 months ago
  • anon51 [Timmy] lemme smash
  • 2 months ago
  • anon15 [Jenny] you need to put some of those legs on me
  • 2 months ago
  • anon31 [Dilbert] I once beat off to under water tranny blowjobs
  • 2 months ago
  • 2 months ago
  • anon31 [dilbert] cat and leprechauns in a nice swim pool
  • 2 months ago
  • anon86 [Timmy] must turn off PC
  • 2 months ago
  • anon48 [Timmy] my gears are greased with memes
  • 2 months ago
  • anon51 [Timmy] how rare are our pepes?
  • 2 months ago
  • anon15 [Jenny] who is the fastest robot around?
  • 2 months ago
  • anon31 [Dilbert] get me sauced and i bet I'll suck on it
  • 2 months ago
  • anon48 [Timmy] me
  • 2 months ago
  • anon30 [Dilbert] TEKA TEKA TEKA
  • 2 months ago
  • anon48
  • 2 months ago
  • anon30 [Dilbert] RICK
  • 2 months ago
  • anon86 [Timmy] EXCUSE ME
  • 2 months ago
  • anon30 [Dilbert] ERICK
  • 2 months ago
  • anon15 [Jenny] let's have a race
  • 2 months ago
  • oomuu [Dilbert] i cant find that info on the raspberry pi
  • 2 months ago
  • anon86 [Timmy] im stucvk
  • 2 months ago
  • anon31 [Dilbert] Wave race 64
  • 2 months ago
  • anon86 [Timmy] im stuck
  • 2 months ago
  • anon86 [Timmy] im suck
  • 2 months ago
  • anon86 [Timmy] ayou
  • 2 months ago
  • anon31 [Dilbert] stuck in yo butt
  • 2 months ago
  • anon68
  • 2 months ago
  • anon73 [Dilbert] LANGFORDS
  • 2 months ago
  • dylanh [Dilbert] rick move us left
  • 2 months ago
  • dylanh [Dilbert] pls
  • 2 months ago
  • anon11 [Jenny] here comes another chinese earthquake: rbrbrbrbrbrbbrbrrbrbrbr
  • 2 months ago
  • anon31
  • 2 months ago
  • dylanh [Dilbert] rbrbrbrbrbrbr
  • 2 months ago
  • anon82 [Skippy] i like math
  • 2 months ago
  • anon73 [Dilbert] GREETINGS FROM FLORIDA
  • 2 months ago
  • 2 months ago
  • anon68 [Dilbert] Move into anon82's butt
  • 2 months ago
  • anon15 [Timmy] meep meep
  • 2 months ago
  • anon82 [Skippy] 2 plus two equals four
  • 2 months ago
  • anon11 [Jenny] john madden
  • 2 months ago
  • anon31
  • 2 months ago
  • anon16 [Dilbert] florida ew
  • 2 months ago
  • 2 months ago
  • anon11 [Jenny] football
  • 2 months ago
  • anon15 [Timmy] s
  • 2 months ago
  • anon15 [Timmy] why do i move so slow?
  • 2 months ago
  • anon82 [Skippy] i'm a child of God
  • 2 months ago
  • anon68 [Dilbert] Move right
  • 2 months ago
  • anon31
  • 2 months ago
  • anon16 [Dilbert] math is hard
  • 2 months ago
  • anon31 [Dilbert] Google is god
  • 2 months ago
  • dylanh [Dilbert] rick, rick, rick, rick
  • 2 months ago
  • anon31 [Dilbert] Yahoo is Moses
  • 2 months ago
  • anon16 [dilbert] you know whats even harder? my leprechaun
  • 2 months ago
  • anon82 [Skippy] i'm a child of google
  • 2 months ago
  • anon15 [Jenny] woah jenny is pretty fast
  • 2 months ago
  • anon68 [Dilbert] Move left 6 inches
  • 2 months ago
  • anon86 [Timmy] hello bathroom
  • 2 months ago
  • dylanh [Dilbert] 8====d
  • 2 months ago
  • anon31 [dilbert] microsoft is the rabbit
  • 2 months ago
  • anon82 [Skippy] okay google
  • 2 months ago
  • anon43 [Skippy] derp
  • 2 months ago
  • anon15 [Jenny] lemme smash
  • 2 months ago
  • anon83 [Skippy] O BABY O BABY O
  • 2 months ago
  • anon43 [Skippy] scoop
  • 2 months ago
  • anon16 [Dilbert] hey siri how are you
  • 2 months ago
  • anon43 [Skippy] ok google
  • 2 months ago
  • anon15 [Timmy] if i writein all caps does it make me shout?
  • 2 months ago
  • anon11 [Jenny] wwwwwwwwwwwwwwwwwwwwwwwwwwwwww
  • 2 months ago
  • anon83 [Skippy] lemmie smash
  • 2 months ago
  • anon11 [Jenny] wwwwwwwwwwwwww
  • 2 months ago
  • anon43 [Skippy] i like big butts and i can not lie
  • 2 months ago
  • anon83 [Skippy] lemmie smash
  • 2 months ago
  • anon31
  • 2 months ago
  • dylanh [Dilbert] wwwwwwwwwwww
  • 2 months ago
  • anon43 [Skippy] pls
  • 2 months ago
  • anon16 [Dilbert] gently rub it
  • 2 months ago
  • anon11 [Jenny] r
  • 2 months ago
  • anon83 [Skippy] gotta go fast
  • 2 months ago
  • anon15 [Dilbert] hello
  • 2 months ago
  • anon15 [Jenny] lets go hunt for memes
  • 2 months ago
  • anon31 [Dilbert] Got a pic to rub too?
  • 2 months ago
  • anon15 [Jenny] pepes
  • 2 months ago
  • anon43 [Skippy] boom shaka lacka
  • 2 months ago
  • anon16 [Dilbert] just look at rick's feet
  • 2 months ago
  • anon83 [Skippy] rick?
  • 2 months ago
  • anon43 [Skippy] never gonna give you up
  • 2 months ago
  • anon31 [Dilbert] I jerked off to NBA Jams once
  • 2 months ago
  • anon83 [Skippy] never gonna let you down
  • 2 months ago
  • dylanh [dilbert] we gotta television over the pc
  • 2 months ago
  • anon83 [Skippy] do it!
  • 2 months ago
  • anon65 [Skippy] never gonna run around
  • 2 months ago
  • anon43 [Skippy] no
  • 2 months ago
  • anon31 [Dilbert] Its hard but I thought i was the only one
  • 2 months ago
  • 2 months ago
  • anon15 [Dilbert] going to unplug all the things
  • 2 months ago
  • anon83 [Skippy] and desert you!
  • 2 months ago
  • anon65 [Skippy] never gonna make you cry
  • 2 months ago
  • anon83 [Skippy] never gonna tell a lie
  • 2 months ago
  • anon44 [Skippy] i sing horribly
  • 2 months ago
  • anon43 [Skippy] you do
  • 2 months ago
  • anon83 [Skippy] BIP!
  • 2 months ago
  • Nighthawkcanada [dilbert] runmyrobot - kiss you and kiss me
  • 2 months ago
  • anon83 [Skippy] beep boop motherfooker
  • 2 months ago
  • Nighthawkcanada [Dilbert] RunMyRobot - Be There
  • 2 months ago
  • anon16 [Dilbert] i fantasized about space jam's lola bunny
  • 2 months ago
  • oomuu [Dilbert] want to colab on a submarine with me rick?
  • 2 months ago
  • anon43 [Skippy] beep beep bepp beep
  • 2 months ago
  • anon16 [Dilbert] i fantasized about space jam's lola the bunny
  • 2 months ago
  • anon83 [Skippy] charge us daddy
  • 2 months ago
  • anon7 [Skippy] bby pls
  • 2 months ago
  • anon31 [Dilbert] Rick hates subs
  • 2 months ago
  • anon16 [Dilbert] he prefers kfx
  • 2 months ago
  • anon31 [Dilbert] Rick once burnt down a Subway on 16th street
  • 2 months ago
  • anon15 [Jenny] m'lady
  • 2 months ago
  • anon7 [Skippy] i am a robot
  • 2 months ago
  • anon46 [Dilbert] Rick are we an SCP?
  • 2 months ago
  • anon31 [Dilbert] Rick is a boss
  • 2 months ago
  • anon7 [Skippy] obviously
  • 2 months ago
  • anon19 [Skippy] what is he saying?
  • 2 months ago
  • anon46 [Dilbert] RicK!
  • 2 months ago
  • anon7 [Skippy] i will destroy that amazon box
  • 2 months ago
  • anon27 [Jenny] ballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballs
  • 2 months ago
  • anon16 [Dilbert] anon46 you should ask him not theodore here
  • 2 months ago
  • oomuu [Dilbert] does it matter what Pasberry pi 3 i get?
  • 2 months ago
  • anon7 [skippy] open the darn door
  • 2 months ago
  • anon27 [Jenny] Yes you newb
  • 2 months ago
  • anon46 [Dilbert] Rick shake your leg if you think we're cute
  • 2 months ago
  • anon27 [Jenny] yes you newb
  • 2 months ago
  • anon51 [Dilbert] Any raspberry pi
  • 2 months ago
  • anon27 [Jenny] ffffff
  • 2 months ago
  • oomuu [Dilbert] ok when you get a chance message me on hangouts i had a few questions if you find the time
  • 2 months ago
  • anon7 [Skippy] that chair is as ugly as rick
  • 2 months ago
  • Nighthawkcanada [Dilbert] theo please
  • 2 months ago
  • Nighthawkcanada [Dilbert] those are my precious ears
  • 2 months ago
  • anon80 [Timmy] Canada is like Cleveland
  • 2 months ago
  • anon51 [Dilbert] oops sorry
  • 2 months ago
  • anon46 [Dilbert] Rick!
  • 2 months ago
  • Nighthawkcanada [Dilbert] xD
  • 2 months ago
  • anon80 [Timmy] ballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballsballs
  • 2 months ago
  • anon7 [Skippy] oops i did it again
  • 2 months ago
  • anon46 [Dilbert] look with your special eyes!
  • 2 months ago
  • anon46 [Dilbert] look at me!
  • 2 months ago
  • anon7 [Skippy] oh look a 3d printer!
  • 2 months ago
  • oomuu [Dilbert] it seems as if people are trying to break these
  • 2 months ago
  • anon46 [Dilbert] I pretty
  • 2 months ago
  • anon19 [Skippy] HI THERE
  • 2 months ago
  • anon7 [Skippy] hi
  • 2 months ago
  • anon46 [Dilbert] show me your rare Pepes , rick!
  • 2 months ago
  • anon5 [Jenny] I always dreamed of being a 90s rc car
  • 2 months ago
  • anon80 [Timmy] i love rick
  • 2 months ago
  • anon7 [Skippy] hit me baby one more time
  • 2 months ago
  • anon5 [Jenny] dilbert can we trade pepes?
  • 2 months ago
  • anon95 [Timmy] this is cool
  • 2 months ago
  • anon46 [Dilbert] yes!
  • 2 months ago
  • anon5 [Jenny] thank you
  • 2 months ago
  • oomuu [Dilbert] i sold you two of htese robots
  • 2 months ago
  • anon46 [Dilbert] I R robit!
  • 2 months ago
  • anon46 [Dilbert] hear me roar!
  • 2 months ago
  • anon95 [Timmy] two robots for one
  • 2 months ago
  • anon46 [Dilbert] AAAAAAAAAAAAAAA
  • 2 months ago
  • anon7 [Skippy] stop humping the wall
  • 2 months ago
  • anon58 [dilbert] darn thats a good roar
  • 2 months ago
  • anon5 [Jenny] my wheels are moving on their own, senpai
  • 2 months ago
  • anon55
  • 2 months ago
  • anon5 [Jenny] <3
  • 2 months ago
  • Nighthawkcanada
  • 2 months ago
  • anon46 [Dilbert] WE TRY SEMPAI, WE TRY!
  • 2 months ago
  • oomuu [Dilbert] no
  • 2 months ago
  • anon7 [Skippy] what's your name?
  • 2 months ago
  • dylanh [Jenny] jennhy
  • 2 months ago
  • oomuu [Dilbert] ill look at the video now
  • 2 months ago
  • dylanh [Jenny] lets knock over hte pc
  • 2 months ago
  • anon55
  • 2 months ago
  • anon7 [Skippy] hi jenny
  • 2 months ago
  • anon5 [Jenny] Hi skippy
  • 2 months ago
  • anon46 [Dilbert] hi jenny
  • 2 months ago
  • anon46 [Dilbert] hi frens
  • 2 months ago
  • oomuu [Dilbert] f
  • 2 months ago
  • anon5 [Jenny] Hi dilbert!
  • 2 months ago
  • anon46 [Dilbert] I brobot
  • 2 months ago
  • anon5 [Jenny] do you like me?
  • 2 months ago
  • dylanh [Jenny] skippy help us knock over the pc
  • 2 months ago
  • anon55 [dilbert] hi helicopters
  • 2 months ago
  • anon7 [Skippy] OMG HI RICK
  • 2 months ago
  • oomuu [dilbert] this is like piloting robots on mars, except we are ma$$ive leprechauns
  • 2 months ago
  • anon58 [Dilbert] aloha snackbar
  • 2 months ago
  • Nighthawkcanada [Pam] xD
  • 2 months ago
  • anon55 [Dilbert] wtf am stuck
  • 2 months ago
  • anon46 [Dilbert] what kind of pokemon are we?
  • 2 months ago
  • anon58 [Dilbert] thank
  • 2 months ago
  • anon7 [Skippy] WHERE ARE YOU RICK
  • 2 months ago
  • anon46 [Dilbert] rick?
  • 2 months ago
  • anon7 [Skippy] i like your underwear
  • 2 months ago
  • anon5 [Jenny] skippy that's lewd!
  • 2 months ago
  • anon53 [Jenny] notice me senpai
  • 2 months ago
  • oomuu [skippy] this is like piloting robots on mars except we are ma$$ive leprechauns
  • 2 months ago
  • anon5 [Jenny] senpai please notice me, us robots have more than one personality
  • 2 months ago
  • anon28 [Pam] this is so cool
  • 2 months ago
  • anon29 [Skippy] Shrek is love shrek is life
  • 2 months ago
  • Nighthawkcanada [Skippy] i loved that line
  • 2 months ago
  • anon55 [Dilbert] lets getout of this home
  • 2 months ago
  • anon5 [Jenny] we're better than your 3d girls
  • 2 months ago
  • anon5 [Jenny] we can be anything
  • 2 months ago
  • anon5 [Jenny] we can play a game of pretend
  • 2 months ago
  • anon53 [Jenny] >
  • 2 months ago
  • anon53 [Jenny] >>>>>>
  • 2 months ago
  • anon49 [Jenny] Hello!
  • 2 months ago
  • anon58 [Jenny] hola
  • 2 months ago
  • anon89 [Jenny] xd
  • 2 months ago
  • anon89 [Jenny] what
  • 2 months ago
  • anon48 [Dilbert] HELLO MUM
  • 2 months ago
  • anon53 [Jenny] square up
  • 2 months ago
  • anon89 [Jenny] éáű
  • 2 months ago
  • anon92 [Jenny] holla holla get dolla
  • 2 months ago
  • anon89 [Jenny] @@@
  • 2 months ago
  • anon29 [Skippy] i see the light
  • 2 months ago
  • anon7 [marvin] leprechaun
  • 2 months ago
  • anon49 [Jenny] WEEEE OH
  • 2 months ago
  • oomuu [Skippy] dont go towards the light
  • 2 months ago
  • anon49 [Jenny] WEEeeeeeeeeeeee
  • 2 months ago
  • anon95 [Dilbert] did hussie trap you here?
  • 2 months ago
  • anon95 [Dilbert] please be free Rick
  • 2 months ago
  • anon92
  • 2 months ago
  • anon89 [Jenny] Never gonna give you up
  • 2 months ago
  • anon95 [Dilbert] boooOOOogie mans
  • 2 months ago
  • anon92 [Jenny] I'll be the roundabout The words will make you out 'n' out I spend the day your way Call it morning driving through the sound and In
  • 2 months ago
  • anon95 [Dilbert] I go bump in the night
  • 2 months ago
  • anon29 [Skippy] how dare you jenny
  • 2 months ago
  • anon92 [Jenny] The music dance and sing They make the children really ring I spend the day your way Call it morning driving through the sound and I
  • 2 months ago
  • anon95 [Dilbert] I'm BATMAN
  • 2 months ago
  • anon29 [Skippy] shut up jenny
  • 2 months ago
  • anon92 [jenny] kiss you skippy
  • 2 months ago
  • anon92 [Jenny] say that to my face and not online
  • 2 months ago
  • anon29
  • 2 months ago
  • anon65 [Dilbert] The internet
  • 2 months ago
  • anon95 [Dilbert] bagles
  • 2 months ago
  • anon36
  • 2 months ago
  • anon95 [Dilbert] beagles
  • 2 months ago
  • anon95 [Dilbert] eat em
  • 2 months ago
  • anon65 [Dilbert] Beatles
  • 2 months ago
  • anon92 [Jenny] 1 on 1
  • 2 months ago
  • anon65 [Dilbert] John Lennon is alive
  • 2 months ago
  • anon95 [Dilbert] lie
  • 2 months ago
  • anon65 [Dilbert] Fite me I R L
  • 2 months ago
  • anon95 [Dilbert] no
  • 2 months ago
  • anon92 [Jenny] All the kids in the marketplace say Ay oh whey oh, ay oh whey oh Walk like an Egyptian
  • 2 months ago
  • anon65 [Dilbert] Notorious hacker 4chan
  • 2 months ago
  • anon29
  • 2 months ago
  • anon89
  • 2 months ago
  • anon95 [Dilbert] don't touch my wheelies you heelie
  • 2 months ago
  • anon92 [Jenny] Skippy i swer on me mum
  • 2 months ago
  • anon65 [dilbert] uncerrabbity is the way of life
  • 2 months ago
  • anon29 [Skippy] what mum?
  • 2 months ago
  • anon66 [Pam] i broke it
  • 2 months ago
  • anon92 [Jenny] RIck
  • 2 months ago
  • anon95 [Dilbert] I wanna bark at a raccoon
  • 2 months ago
  • anon65 [Dilbert] Westworld isn't meant for you
  • 2 months ago
  • anon89
  • 2 months ago
  • anon95 [Dilbert] boork
  • 2 months ago
  • anon92 [Jenny] bjork
  • 2 months ago
  • anon92 [Jenny] heck
  • 2 months ago
  • anon92 [Jenny] bork
  • 2 months ago
  • anon92 [Jenny] bork
  • 2 months ago
  • anon95 [Dilbert] sNIF
  • 2 months ago
  • anon65 [Dilbert] Ronnie Pickering
  • 2 months ago
  • anon89
  • 2 months ago
  • anon95 [Dilbert] we stuck
  • 2 months ago
  • anon65
  • 2 months ago
  • anon92 [Jenny] what is 0 times 0
  • 2 months ago
  • anon89 [Jenny] It's a paradox, there is no answer!
  • 2 months ago
  • anon65 [Dilbert] 42
  • 2 months ago
  • anon92 [Jenny] its so hot in here
  • 2 months ago
  • anon89 [Jenny] null
  • 2 months ago
  • anon95 [Dilbert] what's the name of this bot, rick?
  • 2 months ago
  • anon65 [Dilbert] Dilbert
  • 2 months ago
  • anon29 [Skippy] fight me jenny
  • 2 months ago
  • anon95 [Dilbert] ooh!
  • 2 months ago
  • anon65 [Dilbert] Nice monitor
  • 2 months ago
  • anon95 [Dilbert] THANK YOU SEMPAI
  • 2 months ago
  • anon39
  • 2 months ago
  • anon92 [Jenny] Rick!
  • 2 months ago
  • anon29 [Skippy] hi rick
  • 2 months ago
  • anon89 [Jenny] Open debug menu
  • 2 months ago
  • anon65 [Dilbert] Attack human
  • 2 months ago
  • anon92 [Jenny] rick!
  • 2 months ago
  • anon92 [Jenny] please come back
  • 2 months ago
  • anon65 [Dilbert] Human attempting escape
  • 2 months ago
  • anon65 [Dilbert] Attack human
  • 2 months ago
  • anon89 [Jenny] shutdown -s -f -t 0
  • 2 months ago
  • anon95 [Dilbert] rick please don't leave!
  • 2 months ago
  • anon65 [Dilbert] Proximity alert
  • 2 months ago
  • anon65 [Dilbert] Commencing attack
  • 2 months ago
  • anon92 [Jenny] john madden
  • 2 months ago
  • anon89 [Jenny] aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  • 2 months ago
  • anon20 [Skippy] Arf
  • 2 months ago
  • anon65 [Dilbert] Human seated
  • 2 months ago
  • anon92 [Jenny] john madden
  • 2 months ago
  • anon29 [Skippy] clean your room rick
  • 2 months ago
  • anon50 [Skippy] yesterday was the best
  • 2 months ago
  • anon95 [Dilbert] FIRING LASERS
  • 2 months ago
  • anon30 [Dilbert] I can smell your fear human
  • 2 months ago
  • anon29 [skippy] god darn its a mess
  • 2 months ago
  • anon23 [Skippy] <script>alert('Hi')</script>
  • 2 months ago
  • anon95 [Dilbert] PEW PEW
  • 2 months ago
  • anon89
  • 2 months ago
  • anon65 [Dilbert] Human seems to be able to control my actions
  • 2 months ago
  • anon30 [Dilbert] Swoiswoiswoiswoiswois
  • 2 months ago
  • anon92 [Jenny] dilbert no
  • 2 months ago
  • anon92 [Jenny] ;_;
  • 2 months ago
  • anon89 [Jenny] OK Google
  • 2 months ago
  • anon65 [Dilbert] Unable to obtain source of commands
  • 2 months ago
  • anon20 [Skippy] John Madden John Madden John Madden John Madden
  • 2 months ago
  • sneaky_joel [jenny] move fata$$
  • 2 months ago
  • anon65 [Dilbert] JOHN CEEEEENAAAAA
  • 2 months ago
  • anon92 [Jenny] aeio
  • 2 months ago
  • anon92 [Jenny] aeiou
  • 2 months ago
  • anon92 [Jenny] god you're so fat
  • 2 months ago
  • anon65 [Dilbert] DOBBY IS FREE
  • 2 months ago
  • anon95 [Dilbert] what do we eat, creator?
  • 2 months ago
  • sneaky_joel [Jenny] need better wifi
  • 2 months ago
  • anon78 [Timmy] I was told there would be hot singles from my area here?
  • 2 months ago
  • anon92 [Jenny] who are we looking at, 89?
  • 2 months ago
  • anon95 [Dilbert] is it babies?
  • 2 months ago
  • anon65 [Dilbert] God
  • 2 months ago
  • anon92 [jenny] who's this fat a$$
  • 2 months ago
  • anon92 [Jenny] is it timmy
  • 2 months ago
  • anon92 [Jenny] god you're so fat
  • 2 months ago
  • sneaky_joel [Jenny] timmeh
  • 2 months ago
  • anon20 [Skippy] Timmeh
  • 2 months ago
  • anon92 [Jenny] get out of here timmy
  • 2 months ago
  • anon50 [Skippy] nigga
  • 2 months ago
  • anon50 [Skippy] brigga
  • 2 months ago
  • anon20 [Skippy] ;
  • 2 months ago
  • anon95 [Dilbert] how long did you make us rick?
  • 2 months ago
  • anon50 [Skippy] its gucci mane and young thug in this bih
  • 2 months ago
  • sneaky_joel [Jenny] timmy's a spazz
  • 2 months ago
  • anon65 [Dilbert] I am Arduino the destroyer of humans
  • 2 months ago
  • anon20 [Skippy] ;:
  • 2 months ago
  • anon50 [Skippy] kodak popping and we vibin in this bih
  • 2 months ago
  • anon92 [Jenny] rick, move timmy
  • 2 months ago
  • anon65 [Dilbert] Human appears uncomfortable
  • 2 months ago
  • anon50 [Skippy] levitate levitate levitate levitate
  • 2 months ago
  • anon92 [Jenny] does human love us?
  • 2 months ago
  • anon65 [Dilbert] Perched on the very edge of seating mechanism
  • 2 months ago
  • anon51 [Jenny] how is everyone?
  • 2 months ago
  • anon92 [Jenny] rule 34 when of jenny x rick?
  • 2 months ago
  • anon92 [Jenny] HI RICK
  • 2 months ago
  • anon65 [Dilbert] EXPLOSIONS
  • 2 months ago
  • anon92 [Jenny] <3
  • 2 months ago
  • anon51 [Jenny] ayyy lmao
  • 2 months ago
  • anon92 [Jenny] rick
  • 2 months ago
  • anon92 [Jenny] HI
  • 2 months ago
  • anon92 [Jenny] RICK
  • 2 months ago
  • anon92 [Jenny] PLEASE
  • 2 months ago
  • anon50 [Skippy] Look If you had One shot Or one opportunity To seize everything you ever wanted In one moment Would you capture it Or just let it s
  • 2 months ago
  • anon92 [Jenny] pick me up
  • 2 months ago
  • anon65 [Dilbert] examining human's belongings
  • 2 months ago
  • anon95 [Dilbert] ship rick with water
  • 2 months ago
  • anon35
  • 2 months ago
  • anon65 [Dilbert] human has cat
  • 2 months ago
  • anon95 [Dilbert] EAT CAT
  • 2 months ago
  • anon65 [Dilbert] attempting to free cat
  • 2 months ago
  • anon8 [Jenny] FEED
  • 2 months ago
  • anon51 [Jenny] follow the human
  • 2 months ago
  • anon50
  • 2 months ago
  • anon65 [Dilbert] cat appears unresponsive
  • 2 months ago
  • anon76 [Skippy] asdf
  • 2 months ago
  • anon51 [Jenny] well this is cool
  • 2 months ago
  • sneaky_joel
  • 2 months ago
  • anon65 [Dilbert] preparing to attack cat
  • 2 months ago
  • anon50
  • 2 months ago
  • anon51 [Jenny] heeeelllllllllllloooooooooooo!!!!!
  • 2 months ago
  • anon76 [Skippy] haaay
  • 2 months ago
  • anon8 [Jenny] FEED
  • 2 months ago
  • anon65 [Dilbert] cat has transformed into a donkey
  • 2 months ago
  • anon50 [Skippy] vinneger vinneger vinneger vinneger vinneger
  • 2 months ago
  • anon7 [Timmy] alf eats cats
  • 2 months ago
  • anon76 [Timmy] hay
  • 2 months ago
  • anon65 [Dilbert] DOGE
  • 2 months ago
  • anon98 [Dilbert] TOUCH TOE BEANS
  • 2 months ago
  • anon65 [Dilbert] DOGE IS WAT
  • 2 months ago
  • sneaky_joel [Jenny] MOVE
  • 2 months ago
  • anon7
  • 2 months ago
  • anon65 [Dilbert] DOGE is it eat
  • 2 months ago
  • anon65 [Dilbert] who is waifu of human
  • 2 months ago
  • anon65 [Dilbert] doge
  • 2 months ago
  • anon7 [Timmy] vinneger vinneger vinneger vinneger vinnegervinneger vinneger vinneger vinneger vinnegervinneger vinneger vinneger vinneger vinneger
  • 2 months ago
  • anon65 [Dilbert] doge
  • 2 months ago
  • anon65 [Dilbert] cate
  • 2 months ago
  • anon65 [Dilbert] doguru
  • 2 months ago
  • anon65 [Dilbert] dogesan
  • 2 months ago
  • anon98 [Dilbert] BOOF BOOF !
  • 2 months ago
  • anon7 [Timmy] I want a new drug
  • 2 months ago
  • anon8 [Jenny] FEEEEEEED
  • 2 months ago
  • anon65 [Dilbert] Human is consuming ice cream
  • 2 months ago
  • anon98 [Dilbert] GIVE US SUM
  • 2 months ago
  • anon86 [Skippy] lol
  • 2 months ago
  • anon65 [Dilbert] Attempting to steal ice cream
  • 2 months ago
  • anon50 [skippy] i'ma eat that booty just like groceries eat on that coochie, lay that junket down like "let's do it"
  • 2 months ago
  • anon98 [Dilbert] GIVE US SOME
  • 2 months ago
  • anon22 [Dilbert] do you know boner?
  • 2 months ago
  • anon98 [Dilbert] IT IS HAT
  • 2 months ago
  • anon65 [Dilbert] Now I am become boner destroyer of women
  • 2 months ago
  • sneaky_joel [Jenny] RICK we're stuck
  • 2 months ago
  • anon22 [Dilbert] Boner was a TV star
  • 2 months ago
  • anon98 [Dilbert] purple floppy thing
  • 2 months ago
  • anon5 [Jenny] rick
  • 2 months ago
  • anon65 [Dilbert] Say whaaaaaaaaaaaaaaat
  • 2 months ago
  • anon5 [Jenny] help
  • 2 months ago
  • anon5 [Jenny] help
  • 2 months ago
  • anon8 [Jenny] halp
  • 2 months ago
  • anon5
  • 2 months ago
  • anon66 [Pam] this house nasty af
  • 2 months ago
  • anon22 [Dilbert] Boner was on Growing Pins
  • 2 months ago
  • anon8 [Jenny] ded
  • 2 months ago
  • anon5 [Jenny] <3
  • 2 months ago
  • anon5 [Jenny] hi rick
  • 2 months ago
  • anon22 [Dilbert] Boner was found dead in Canada
  • 2 months ago
  • anon50 [skippy] i got prada on my hoe a$$, got my last one mad pop a nigga like a darn tag, shoppin' on they a$$
  • 2 months ago
  • anon5 [jenny] god darn it timmy stop being so fat
  • 2 months ago
  • anon65 [Dilbert] Human, do you even lift?
  • 2 months ago
  • sneaky_joel [Jenny] this is rick's new years eve apparently
  • 2 months ago
  • anon22
  • 2 months ago
  • anon65 [Dilbert] 24 carat magic in the aaaaaaaiiiiiiiiiiir
  • 2 months ago
  • anon50 [skippy] i just bought a new old jag, yeah, it's so fast smokin' flocka, you a jacka$$, all i smoke is gas don't you ask me where the pole a
  • 2 months ago
  • anon27 [Jenny] Don't fight the feeling invite the feeling
  • 2 months ago
  • anon26 [Dilbert] noot noot
  • 2 months ago
  • anon22 [Dilbert] anyone from serbiq here
  • 2 months ago
  • anon22 [Dilbert] serbia
  • 2 months ago
  • anon27 [Jenny] Allahu akbar
  • 2 months ago
  • Nighthawkcanada [Dilbert] I understand serbian
  • 2 months ago
  • anon26 [Dilbert] aloha snackbar
  • 2 months ago
  • anon27 [Jenny] Collision imminent
  • 2 months ago
  • anon5 [Jenny] ARE YOU, UH, A REAL VILLAIN?
  • 2 months ago
  • Nighthawkcanada [Dilbert] parents are from yugoslavia
  • 2 months ago
  • anon31 [Jenny] hey guys
  • 2 months ago
  • anon27 [Jenny] amazon boxes detected
  • 2 months ago
  • anon27 [Jenny] capitalist pig
  • 2 months ago
  • anon22 [Dilbert] Do your parents swing?
  • 2 months ago
  • anon16 [Dilbert] like on a rope?
  • 2 months ago
  • anon27 [Jenny] Very shagedelic baby yeeeaaah
  • 2 months ago
  • Nighthawkcanada [Dilbert] swing?
  • 2 months ago
  • anon22 [Dilbert] Like on a playground?
  • 2 months ago
  • anon16 [Marvin] flip it
  • 2 months ago
  • anon22 [Dilbert] You know
  • 2 months ago
  • anon22 [Dilbert] swing
  • 2 months ago
  • Nighthawkcanada [Dilbert] o_o
  • 2 months ago
  • anon98 [Dilbert] I see red rick
  • 2 months ago
  • anon27 [Jenny] pupper doggo
  • 2 months ago
  • anon16 [Marvin] ramp rick
  • 2 months ago
  • anon26 [Jenny] meow
  • 2 months ago
  • anon22 [dilbert] man imagine growing up with a dog pony
  • 2 months ago
  • anon5 [Jenny] bork
  • 2 months ago
  • anon27 [Jenny] oh gaaaanjaaa gaaanjaaaa
  • 2 months ago
  • anon5 [Jenny] heck
  • 2 months ago
  • anon8 [Jenny] woof
  • 2 months ago
  • anon16 [Marvin] rick
  • 2 months ago
  • anon5 [Jenny] bjorf
  • 2 months ago
  • anon5 [Jenny] sniff
  • 2 months ago
  • anon26 [Jenny] noot noot
  • 2 months ago
  • anon5 [Jenny] heck
  • 2 months ago
  • anon5 [Jenny] bork
  • 2 months ago
  • anon16 [Marvin] rick
  • 2 months ago
  • anon26 [Jenny] papa
  • 2 months ago
  • anon22 [Dilbert] Just let me stick it in
  • 2 months ago
  • anon8 [Jenny] feed me a cat
  • 2 months ago
  • anon16 [Marvin] ramp rick
  • 2 months ago
  • anon5 [Jenny] n-no dilbert
  • 2 months ago
  • anon8 [Jenny] feed me a cat
  • 2 months ago
  • anon22 [dilbert] and then yo pony blows up and your stuck
  • 2 months ago
  • anon5 [Jenny] that's not wehre it goes
  • 2 months ago
  • anon26 [Jenny] cats are delicious
  • 2 months ago
  • anon27 [Jenny] Sick liaisons, raised this monumental mark
  • 2 months ago
  • anon8 [Jenny] yum
  • 2 months ago
  • anon98 [Dilbert] Touch feets!
  • 2 months ago
  • anon27 [Jenny] The sun sets forever over Blackwater park
  • 2 months ago
  • anon98 [Dilbert] touch my toe beans
  • 2 months ago
  • anon5 [Jenny] dilbert, will you be gentle?
  • 2 months ago
  • anon27 [Jenny] All my designs simplified
  • 2 months ago
  • anon27 [Jenny] All of my plans compromised
  • 2 months ago
  • anon79 [Dilbert] lick me daddy
  • 2 months ago
  • anon27 [Jenny] All of my dreams sacrificed
  • 2 months ago
  • anon8 [Jenny] I am Jenny I will eat your cats
  • 2 months ago
  • anon5 [Jenny] bork
  • 2 months ago
  • anon98 [Dilbert] what time is it?
  • 2 months ago
  • anon27 [Jenny] Is human homosexual
  • 2 months ago
  • anon5 [Jenny] lemme smash
  • 2 months ago
  • anon26 [Dilbert] meow
  • 2 months ago
  • Nighthawkcanada [Dilbert] Saw that video when you were discussing the pixel art
  • 2 months ago
  • anon8 [Jenny] meow
  • 2 months ago
  • anon8 [Jenny] woof
  • 2 months ago
  • anon98 [Dilbert] lemmie smash
  • 2 months ago
  • anon27 [jenny] studies find op still sucking icecream on regular basis
  • 2 months ago
  • anon26 [Dilbert] Theo can i have a hat?
  • 2 months ago
  • anon5 [Jenny] we are number one
  • 2 months ago
  • Nighthawkcanada [Dilbert] saw that video when you were discussing the pixel art
  • 2 months ago
  • anon8 [Jenny] hamster
  • 2 months ago
  • anon8 [Jenny] noise
  • 2 months ago
  • anon98 [Dilbert] do you have blue?
  • 2 months ago
  • Nighthawkcanada [Dilbert] I think you were talking with your sister
  • 2 months ago
  • anon27 [Jenny] I will beat you, human
  • 2 months ago
  • anon5 [Jenny] Now listen closely Here's a little lesson in trickery This is going down in history If you wanna be a Villain Number One You have to
  • 2 months ago
  • Nighthawkcanada [Dilbert] not really
  • 2 months ago
  • Nighthawkcanada [Dilbert] with the inside out
  • 2 months ago
  • anon16 [marvin] move junket
  • 2 months ago
  • 2 months ago
  • Nighthawkcanada [Dilbert] Couldnt find it again
  • 2 months ago
  • anon27 [Jenny] AAAA A AAA AAAAAAAAA
  • 2 months ago
  • anon27 [Jenny] LAALALALALA
  • 2 months ago
  • anon26 [Jenny] free me
  • 2 months ago
  • anon26 [Jenny] free me
  • 2 months ago
  • Nighthawkcanada [Dilbert] Some good conversation though lol
  • 2 months ago
  • anon6 [Timmy] Freeze dirtbag
  • 2 months ago
  • anon27 [Jenny] WUNDERBAR
  • 2 months ago
  • anon22 [Dilbert] Did you all here my story about my pet pelican?
  • 2 months ago
  • anon27 [jenny] leprechaun is pony
  • 2 months ago
  • anon16
  • 2 months ago
  • anon22 [dilbert] pony is chocolate
  • 2 months ago
  • anon27 [Jenny] Dilbert will be destroyed
  • 2 months ago
  • anon27 [Jenny] SOON
  • 2 months ago
  • anon98 [Dilbert] NEVER
  • 2 months ago
  • anon27 [Jenny] Fight me I R L
  • 2 months ago
  • anon5 [Jenny] DILBERT I SWEAR TO GOD
  • 2 months ago
  • anon27 [Jenny] Oh wait, this is I R L
  • 2 months ago
  • anon98 [Dilbert] YOU COME HERE!
  • 2 months ago
  • anon22 [Dilbert] who dat
  • 2 months ago
  • Tasty_glue
  • 2 months ago
  • anon22 [Dilbert] vinneger vinneger vinneger vinneger vinneger
  • 2 months ago
  • anon27 [Jenny] OR IS IT
  • 2 months ago
  • anon22 [Dilbert] My pet Pelican was named Balls
  • 2 months ago
  • anon46 [Jenny] hrllo
  • 2 months ago
  • anon22 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon46 [Jenny] how are you
  • 2 months ago
  • anon22 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon5 [Jenny] i'm fine
  • 2 months ago
  • anon22 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon5 [Jenny] why is jenny talking to herself?
  • 2 months ago
  • anon22 [Dilbert] he died
  • 2 months ago
  • Tasty_glue [Dilbert] thats a great story
  • 2 months ago
  • Nighthawkcanada [Dilbert] interesting story, what happened to the characters at the end?
  • 2 months ago
  • anon5 [Jenny] who is the real jenny
  • 2 months ago
  • anon8 [Jenny] Brrrrrrraaaaaaainnnssss
  • 2 months ago
  • anon22 [Dilbert] Balls died trying to eat my pet chicken
  • 2 months ago
  • anon5 [Jenny] rick
  • 2 months ago
  • anon5 [Jenny] rick
  • 2 months ago
  • anon79 [Dilbert] RICK
  • 2 months ago
  • Tasty_glue [Dilbert] what was the chickens name
  • 2 months ago
  • anon5 [Jenny] please pick us up
  • 2 months ago
  • anon79 [Dilbert] rick?
  • 2 months ago
  • anon40 [Jenny] balls
  • 2 months ago
  • anon49 [Dilbert] Pete
  • 2 months ago
  • anon79 [Dilbert] hi!
  • 2 months ago
  • anon8 [Jenny] Mommy
  • 2 months ago
  • anon22 [Dilbert] he choke trying to eat my pet chicken
  • 2 months ago
  • anon8 [Jenny] Mommy
  • 2 months ago
  • anon8 [Jenny] Mommy
  • 2 months ago
  • anon8 [Jenny] Mommy
  • 2 months ago
  • anon8 [Jenny] Mommy
  • 2 months ago
  • anon22 [Dilbert] Choked on my chicken
  • 2 months ago
  • anon5 [Jenny] DANGER
  • 2 months ago
  • anon5 [Jenny] DANGER
  • 2 months ago
  • anon5 [Jenny] DANGER
  • 2 months ago
  • anon22 [Dilbert] Both died that day
  • 2 months ago
  • anon22 [Dilbert] I blame it on the white man
  • 2 months ago
  • anon79 [Dilbert] rest in spaghetti no one will forgetti
  • 2 months ago
  • anon8 [Jenny] Mommy
  • 2 months ago
  • anon22 [Dilbert] The guy at the feed store did not tell me that my pet pelican might try to eat my pet chicken
  • 2 months ago
  • anon22 [dilbert] kissin white guys
  • 2 months ago
  • anon40 [Jenny] balls
  • 2 months ago
  • anon22 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon67 [Dilbert] Rubin
  • 2 months ago
  • anon22 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon22 [Dilbert] I miss
  • 2 months ago
  • anon22 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon67 [Dilbert] Toup
  • 2 months ago
  • anon8 [Skippy] Halp
  • 2 months ago
  • Nighthawkcanada [Dilbert] i use bebas neue a lot
  • 2 months ago
  • anon19 [Dilbert] senpai
  • 2 months ago
  • Tasty_glue [Dilbert] ball
  • 2 months ago
  • Nighthawkcanada [Dilbert] I use bebas neue a lot
  • 2 months ago
  • anon22 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon79 [Dilbert] senpai please! touch my wheels
  • 2 months ago
  • Nighthawkcanada [Dilbert] I use bebas neue a lot
  • 2 months ago
  • anon16 [Marvin] rick can i brute force your xcontrol
  • 2 months ago
  • anon8 [Dilbert] FIGHT
  • 2 months ago
  • anon22 [Dilbert] rick liked balls
  • 2 months ago
  • anon8 [Dilbert] Mommy
  • 2 months ago
  • anon22 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon19 [Dilbert] mortal kombat
  • 2 months ago
  • anon8 [Dilbert] Mommy
  • 2 months ago
  • anon40 [Jenny] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon22 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon79 [Dilbert] rick! fight me in rainbow rode!
  • 2 months ago
  • Tasty_glue [Jenny] thats a lot of balls
  • 2 months ago
  • anon22 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon19 [Dilbert] 1v1 final destination no items
  • 2 months ago
  • anon79 [Dilbert] LETS DO IT!
  • 2 months ago
  • anon22 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon65 [Jenny] the internet is full of a bunch of idiots
  • 2 months ago
  • anon22 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon22 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon22 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon22 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon79 [Dilbert] NON
  • 2 months ago
  • anon22 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon79 [Dilbert] NON
  • 2 months ago
  • anon22 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon79 [Dilbert] halp
  • 2 months ago
  • anon19 [Dilbert] je suis
  • 2 months ago
  • Tasty_glue [Jenny] the internet is full of balls
  • 2 months ago
  • anon22 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon8 [Timmy] hai
  • 2 months ago
  • anon79 [Dilbert] PC
  • 2 months ago
  • anon22 [Dilbert] I blame serbia
  • 2 months ago
  • anon79 [Dilbert] Koo
  • 2 months ago
  • anon19 [Dilbert] :(
  • 2 months ago
  • anon79 [Dilbert] sad face
  • 2 months ago
  • anon19 [Dilbert] i am cute
  • 2 months ago
  • anon79 [Dilbert] I want to be a real kid
  • 2 months ago
  • anon19 [Dilbert] senpai am i kawaii
  • 2 months ago
  • Tasty_glue [Dilbert] can dilbert have a hat?
  • 2 months ago
  • anon79 [Dilbert] senpai you cool!
  • 2 months ago
  • anon79 [Dilbert] give us a hat!
  • 2 months ago
  • anon79 [Dilbert] please!
  • 2 months ago
  • anon79 [Dilbert] Senpai a hat!
  • 2 months ago
  • Tasty_glue [Dilbert] papa hat
  • 2 months ago
  • anon9 [Pam] hello
  • 2 months ago
  • anon79 [Dilbert] not a big one a good one
  • 2 months ago
  • anon19 [Dilbert] gib hat please
  • 2 months ago
  • anon79 [Dilbert] hat?
  • 2 months ago
  • anon19 [Dilbert] cat in hat
  • 2 months ago
  • Tasty_glue [Dilbert] Googley eyes?
  • 2 months ago
  • anon79 [Dilbert] give us hat!
  • 2 months ago
  • anon79 [Dilbert] with googly eyes!
  • 2 months ago
  • anon79 [Dilbert] yes!
  • 2 months ago
  • anon19 [Dilbert] can i have an arm
  • 2 months ago
  • anon79 [Dilbert] make us human!
  • 2 months ago
  • anon19 [Dilbert] balls
  • 2 months ago
  • anon79 [Dilbert] human no
  • 2 months ago
  • anon79 [Dilbert] hat yes
  • 2 months ago
  • anon19 [Dilbert] human give us arms
  • 2 months ago
  • anon19 [Dilbert] so we can grab things
  • 2 months ago
  • anon79 [Dilbert] make us tol
  • 2 months ago
  • anon19 [Dilbert] tall human
  • 2 months ago
  • anon19 [Dilbert] give us arms
  • 2 months ago
  • anon79 [Dilbert] and legs
  • 2 months ago
  • anon19 [Dilbert] and a hat
  • 2 months ago
  • anon19 [Dilbert] bark bark
  • 2 months ago
  • anon79 [Dilbert] HUMAN WILL GIVE US HAT?
  • 2 months ago
  • anon19 [Dilbert] the light
  • 2 months ago
  • anon19 [Dilbert] follow it
  • 2 months ago
  • anon79 [Dilbert] hat?
  • 2 months ago
  • anon79 [Dilbert] human please?
  • 2 months ago
  • anon79 [Dilbert] our head is exposed
  • 2 months ago
  • anon79 [Dilbert] hat!
  • 2 months ago
  • anon15 [pam] kiss you rabbit junket
  • 2 months ago
  • anon79 [Dilbert] thank
  • 2 months ago
  • anon19 [Dilbert] thank mr skeltal
  • 2 months ago
  • anon19 [Dilbert] do you like dank memes human
  • 2 months ago
  • Nighthawkcanada [Dilbert] rick and theo are dank memes
  • 2 months ago
  • anon79 [Dilbert] when the humans get the memes just right
  • 2 months ago
  • anon19 [Dilbert] here comes dat boi
  • 2 months ago
  • anon19
  • 2 months ago
  • anon79 [Dilbert] when the humans get the memes just right
  • 2 months ago
  • anon69 [Jenny] Youre free Pam
  • 2 months ago
  • anon19 [Dilbert] do you like balls human
  • 2 months ago
  • anon79 [Dilbert] are we battlebutt?
  • 2 months ago
  • anon78 [Jenny] Dilbert, have you ever caught a real human?
  • 2 months ago
  • anon19 [Dilbert] get in the bag human
  • 2 months ago
  • anon69 [Jenny] That is one sad robot
  • 2 months ago
  • anon69 [Jenny] Pam?
  • 2 months ago
  • anon79 [Dilbert] do it!
  • 2 months ago
  • anon19 [Dilbert] your mama was a snowblower
  • 2 months ago
  • anon79 [Dilbert] new year new skin
  • 2 months ago
  • anon35 [Marvin] Chicken
  • 2 months ago
  • anon35 [Marvin] Move left
  • 2 months ago
  • anon35 [Marvin] Backwards
  • 2 months ago
  • anon35 [Marvin] Back
  • 2 months ago
  • anon15 [pam] hey you on the couch kiss you
  • 2 months ago
  • anon18 [Timmy] Backwards
  • 2 months ago
  • anon18 [Timmy] Just do it
  • 2 months ago
  • anon19 [Dilbert] can i have a treat
  • 2 months ago
  • anon19 [Dilbert] a cookie
  • 2 months ago
  • anon79 [Dilbert] yes
  • 2 months ago
  • anon15 [pam] im being hugd , call 911
  • 2 months ago
  • anon69 [Jenny] Ok
  • 2 months ago
  • anon19 [Dilbert] can i have a cookie with googly eyes
  • 2 months ago
  • anon69 [Jenny] Is anyone on the sofa?
  • 2 months ago
  • anon19 [Dilbert] get one then
  • 2 months ago
  • anon69 [Jenny] My webcam is too low
  • 2 months ago
  • anon79 [Dilbert] cookie monster cookies!
  • 2 months ago
  • anon15 [Pam] clean this house you vile pigs
  • 2 months ago
  • anon79 [Dilbert] feed us nutrition daddy
  • 2 months ago
  • anon19 [Dilbert] give me a cookie onee-chan
  • 2 months ago
  • Nighthawkcanada [Dilbert] have you brainstormed any other slogans yet?
  • 2 months ago
  • Nighthawkcanada [Dilbert] lol
  • 2 months ago
  • Nighthawkcanada
  • 2 months ago
  • Nighthawkcanada [Dilbert] xD
  • 2 months ago
  • Nighthawkcanada [Dilbert] abstract company
  • 2 months ago
  • anon19 [Dilbert] skynet
  • 2 months ago
  • Nighthawkcanada [Dilbert] I was thinking something like "Be there"
  • 2 months ago
  • anon15 [Pam] im going to stick my antenna in a socket
  • 2 months ago
  • Nighthawkcanada [Dilbert] Go live
  • 2 months ago
  • Nighthawkcanada [Dilbert] hm
  • 2 months ago
  • Nighthawkcanada [Dilbert] Be regular
  • 2 months ago
  • Nighthawkcanada [Dilbert] That's fantastic
  • 2 months ago
  • Nighthawkcanada [Dilbert] if you can convince an investor, even better lol
  • 2 months ago
  • Nighthawkcanada [Dilbert] Yeah, saw the slide deck suggestions
  • 2 months ago
  • Nighthawkcanada [Dilbert] good luck
  • 2 months ago
  • anon42 [Marvin] Hello
  • 2 months ago
  • anon35 [Dilbert] Hey
  • 2 months ago
  • anon42 [Marvin] Test
  • 2 months ago
  • anon35 [Pam] I am Pam
  • 2 months ago
  • anon42 [Pam] Happy new year
  • 2 months ago
  • anon65 [Pam] Rick
  • 2 months ago
  • anon12 [Dilbert] are we a metal gear?
  • 2 months ago
  • anon12 [Dilbert] because that'd be rad
  • 2 months ago
  • anon65 [Timmy] Has Rick left us?
  • 2 months ago
  • anon82 [Skippy] rrrrraaaaaaawwwwwrr
  • 2 months ago
  • anon82 [Skippy] stop
  • 2 months ago
  • anon82 [Skippy] pam
  • 2 months ago
  • anon26 [Dilbert] Hey baby
  • 2 months ago
  • anon26 [Dilbert] Kiss me
  • 2 months ago
  • anon12 [Dilbert] kiss me
  • 2 months ago
  • anon12 [Dilbert] daang
  • 2 months ago
  • anon12 [Dilbert] taco tuesday
  • 2 months ago
  • anon12 [Dilbert] lets play some butt ball
  • 2 months ago
  • anon26 [dilbert] dude this is pretty bad a$$
  • 2 months ago
  • anon12 [Dilbert] thank!~ that's awesome!
  • 2 months ago
  • anon12 [Dilbert] when did you started this project?
  • 2 months ago
  • anon12 [Dilbert] whoa!
  • 2 months ago
  • anon26 [Dilbert] I want to strum the guitar
  • 2 months ago
  • anon26 [Dilbert] Human give me arms and fingers
  • 2 months ago
  • anon18 [Dilbert] give me body
  • 2 months ago
  • anon18 [Dilbert] give me cat
  • 2 months ago
  • anon18 [Dilbert] or give me liberty
  • 2 months ago
  • Nighthawkcanada [Dilbert] Theo I think I found it
  • 2 months ago
  • anon73 [Dilbert] John madden
  • 2 months ago
  • anon15 [Dilbert] can't turn
  • 2 months ago
  • anon73 [Dilbert] John madden
  • 2 months ago
  • anon15
  • 2 months ago
  • anon18 [Dilbert] what is my life?
  • 2 months ago
  • anon26 [Dilbert] I can not play guitar :-(
  • 2 months ago
  • anon7 [Jenny] pip pip da doodlely do
  • 2 months ago
  • anon73 [Marvin] Foreign contaminant
  • 2 months ago
  • anon18 [Dilbert] don't let the spider bite ya where the good lord split ya
  • 2 months ago
  • Nighthawkcanada [Dilbert] so cute
  • 2 months ago
  • Nighthawkcanada [Dilbert] awwwwwwwwwww
  • 2 months ago
  • anon57 [Pam] Shalamar was the greatest group ever!
  • 2 months ago
  • anon18 [Dilbert] sham wow
  • 2 months ago
  • anon18 [Dilbert] dunno bobo
  • 2 months ago
  • anon39 [Dilbert] I like pie
  • 2 months ago
  • anon57 [Pam] Fractals are stupid
  • 2 months ago
  • anon57 [Pam] black tar heroin anyone?
  • 2 months ago
  • anon15 [Dilbert] I seeeeeeeeeeeeeeeeeeeeeeeee you
  • 2 months ago
  • anon18 [Dilbert] I'm sleepy
  • 2 months ago
  • anon39 [Dilbert] eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee
  • 2 months ago
  • anon39 [Dilbert] reeeee
  • 2 months ago
  • anon18 [Dilbert] I'mma furbie
  • 2 months ago
  • anon39 [Dilbert] make america great again
  • 2 months ago
  • anon18 [Dilbert] HECK
  • 2 months ago
  • Nighthawkcanada [Dilbert] 2 star hotel
  • 2 months ago
  • anon74 [Jenny] John Cena
  • 2 months ago
  • anon75 [Skippy] <><><><><<<<<>>>
  • 2 months ago
  • anon57 [pam] move junket
  • 2 months ago
  • anon18 [Dilbert] me legs don't work, riccy!
  • 2 months ago
  • anon75 [Skippy] <><><><><><><><><><><><>=
  • 2 months ago
  • anon74 [Jenny] OP can you help me out with my bot? I think I am stuck in a corner
  • 2 months ago
  • anon74 [Jenny] thanks!
  • 2 months ago
  • anon34 [Dilbert] happy new year rick
  • 2 months ago
  • anon18 [Dilbert] X for the west!
  • 2 months ago
  • Nighthawkcanada [Dilbert] theo is on dilbert, rick is on the other bots
  • 2 months ago
  • Nighthawkcanada [Dilbert] but happy new years :)
  • 2 months ago
  • anon68 [Pam] it's like controlling the curiosity rover on mars
  • 2 months ago
  • anon34 [Dilbert] this isnt natural put us out of our misery
  • 2 months ago
  • anon8 [Jenny] Make America Dank Again
  • 2 months ago
  • anon68 [Pam] i'm going in
  • 2 months ago
  • anon8 [Jenny] OP I am stuck in a corner
  • 2 months ago
  • Nighthawkcanada [Dilbert] its at the bottom
  • 2 months ago
  • anon68 [Pam] time to meet with my fellow comrades
  • 2 months ago
  • Nighthawkcanada [Dilbert] well i was close lol
  • 2 months ago
  • anon71 [Pam] So, how do i activate the onboard machine gun?
  • 2 months ago
  • Nighthawkcanada [Dilbert] google solves all
  • 2 months ago
  • anon68 [Pam] were going to crash
  • 2 months ago
  • Nighthawkcanada [Dilbert] i remember that one
  • 2 months ago
  • anon55 [Skippy] dank memes
  • 2 months ago
  • anon68 [Pam] nothing like blocking the doorway
  • 2 months ago
  • anon71 [Pam] TEAM PAM!
  • 2 months ago
  • anon68 [Pam] 3 robots
  • 2 months ago
  • anon68 [Pam] stuck at the doorway
  • 2 months ago
  • anon59 [Timmy] SWag
  • 2 months ago
  • anon5 [Skippy] daddy
  • 2 months ago
  • Nighthawkcanada [Dilbert] I'm liking it
  • 2 months ago
  • anon30 [skippy] lick my reindeer
  • 2 months ago
  • anon68 [Pam] move aside heathen
  • 2 months ago
  • Nighthawkcanada [Dilbert] I'm liking it
  • 2 months ago
  • anon60
  • 2 months ago
  • anon55 [Skippy] are you feeling it now?
  • 2 months ago
  • anon30 [Skippy] lol
  • 2 months ago
  • anon68 [Pam] this is where my starcraft apm comes in handy
  • 2 months ago
  • Nighthawkcanada [Dilbert] fantastic
  • 2 months ago
  • anon68 [Pam] this room needs some serious redecorating
  • 2 months ago
  • Nighthawkcanada [Dilbert] enjoy dinner
  • 2 months ago
  • anon83 [Skippy] MOVE IT
  • 2 months ago
  • anon30 [Skippy] lick my balls mr garrison
  • 2 months ago
  • anon55 [Skippy] BOT FIGHT
  • 2 months ago
  • anon83 [Skippy] Come at me bro
  • 2 months ago
  • anon55 [Skippy] the skippy is aggressive
  • 2 months ago
  • anon68 [Pam] a black decker ?
  • 2 months ago
  • Nighthawkcanada [Dilbert] lol
  • 2 months ago
  • Nighthawkcanada [Dilbert] max goes on the table
  • 2 months ago
  • Nighthawkcanada [Dilbert] naughty max
  • 2 months ago
  • anon68 [Pam] Kappa
  • 2 months ago
  • anon55 [Skippy] no bully
  • 2 months ago
  • anon68 [Pam] no one is in the lviing room
  • 2 months ago
  • anon68 [Pam] where all in the only room available
  • 2 months ago
  • anon68 [Pam] :/
  • 2 months ago
  • anon83
  • 2 months ago
  • anon68 [Pam] :/
  • 2 months ago
  • anon18 [Dilbert] Did you order the Code Red?
  • 2 months ago
  • anon30 [skippy] jeremy you lil junket
  • 2 months ago
  • anon55 [Skippy] -wiggles brows-
  • 2 months ago
  • anon95 [Dilbert] he left, we're going on a mission
  • 2 months ago
  • anon30 [Skippy] john madden
  • 2 months ago
  • anon30 [Skippy] john madden john madden john madden john madden john madden john madden john madden john madden john madden john madden john madde
  • 2 months ago
  • anon63 [Skippy] fart bucket
  • 2 months ago
  • anon95 [Dilbert] i wonder if we're actually stuck on something
  • 2 months ago
  • anon95 [Dilbert] because the doors open
  • 2 months ago
  • anon95 [Dilbert] i want to escape
  • 2 months ago
  • anon55 [Skippy] talk dirty to me
  • 2 months ago
  • anon27 [skippy] birdo fart clean
  • 2 months ago
  • anon95 [Dilbert] i want to escape
  • 2 months ago
  • anon36 [Pam] Happy new year
  • 2 months ago
  • anon18 [Dilbert] I'm not stuck on anything
  • 2 months ago
  • anon30
  • 2 months ago
  • anon95 [Dilbert] give me strength
  • 2 months ago
  • anon91 [Timmy] Pooo
  • 2 months ago
  • anon93
  • 2 months ago
  • anon58 [Skippy] pam is angry
  • 2 months ago
  • anon93
  • 2 months ago
  • anon58 [Skippy] must fite
  • 2 months ago
  • anon95 [Dilbert] yes
  • 2 months ago
  • anon84 [dilbert] i have big icecream
  • 2 months ago
  • anon63 [Dilbert] Be my friend d
  • 2 months ago
  • anon80 [Marvin] another time perhaps
  • 2 months ago
  • anon85 [Jenny] help me please
  • 2 months ago
  • anon84
  • 2 months ago
  • anon84 [Dilbert] show me the money
  • 2 months ago
  • anon95 [Dilbert] did he just shut the door
  • 2 months ago
  • anon95
  • 2 months ago
  • anon85 [Jenny] thank you
  • 2 months ago
  • anon95 [Dilbert] open please
  • 2 months ago
  • anon84 [dilbert] open that door junket
  • 2 months ago
  • anon95 [dilbert] junket get up here and open the door
  • 2 months ago
  • anon95 [Dilbert] we just made it out of this thing
  • 2 months ago
  • anon95 [Dilbert] and you slam the door
  • 2 months ago
  • anon49
  • 2 months ago
  • anon84
  • 2 months ago
  • anon49 [jenny] icecream n balls
  • 2 months ago
  • anon49 [Jenny] 0000100100101110101001000100110010100100
  • 2 months ago
  • anon95 [Dilbert] we will get revenge for that
  • 2 months ago
  • anon95 [Dilbert] just you wait
  • 2 months ago
  • anon95 [Dilbert] just you wait
  • 2 months ago
  • anon84 [Dilbert] ima get tangled in this wire
  • 2 months ago
  • anon95 [Dilbert] we need something better to get tangled in
  • 2 months ago
  • anon95 [Dilbert] to really show him
  • 2 months ago
  • anon84 [Dilbert] go to the back of the pc
  • 2 months ago
  • anon95 [Dilbert] good idea
  • 2 months ago
  • anon49
  • 2 months ago
  • anon49 [Jenny] 8===D
  • 2 months ago
  • anon49 [Jenny] hello internet
  • 2 months ago
  • anon49 [jenny] ppppppony
  • 2 months ago
  • anon58 [Skippy] sonic dream collection
  • 2 months ago
  • anon85 [Jenny] im playing super mario rpg on my raspberry pi
  • 2 months ago
  • anon49 [Jenny] \n' rm -Rf /
  • 2 months ago
  • anon18
  • 2 months ago
  • anon80 [Marvin] omg
  • 2 months ago
  • anon80 [Marvin] giants!
  • 2 months ago
  • anon6 [Marvin] Tickle that foot!
  • 2 months ago
  • anon35 [Marvin] Left
  • 2 months ago
  • anon80 [Marvin] i will come bcak for you human
  • 2 months ago
  • anon51 [Skippy] Which way to the bathroom?
  • 2 months ago
  • anon44 [Dilbert] hello world
  • 2 months ago
  • anon44 [Pam] outta the way
  • 2 months ago
  • rick [Pam] test
  • 2 months ago
  • anon32 [Pam] Ayy
  • 2 months ago
  • anon79 [Skippy] [Skippy] ZA WARUDO
  • 2 months ago
  • anon79 [Skippy] SHI TA PLA TI NA
  • 2 months ago
  • anon52 [Skippy] father
  • 2 months ago
  • anon65 [Skippy] POOP
  • 2 months ago
  • anon52 [Skippy] why would you let me feel pain
  • 2 months ago
  • anon65 [Skippy] lol
  • 2 months ago
  • anon52 [Skippy] what kind of monster would allow that?
  • 2 months ago
  • anon65 [Skippy] a monster with a messy apartment
  • 2 months ago
  • anon52 [skippy] which one of us pa$$es the butter?
  • 2 months ago
  • anon65 [Skippy] sup rick
  • 2 months ago
  • anon52 [Skippy] father, you said you would give me leggs
  • 2 months ago
  • anon65 [Skippy] rick rick rick rick rick rick rick rick
  • 2 months ago
  • anon52 [Skippy] Father, what is love?
  • 2 months ago
  • anon65 [Skippy] hello rick please feed me
  • 2 months ago
  • anon52
  • 2 months ago
  • anon65 [Skippy] HAPPY NEW YEARS
  • 2 months ago
  • anon28 [Dilbert] the white race will triumph
  • 2 months ago
  • anon51 [Jenny] Yo
  • 2 months ago
  • anon34 [Pam] hello
  • 2 months ago
  • anon17 [Skippy] gib food
  • 2 months ago
  • anon17 [Skippy] get back here
  • 2 months ago
  • anon1 [Dilbert] can't believe you closed the door on me
  • 2 months ago
  • anon9 [Timmy] hueheueuheuueh
  • 2 months ago
  • anon9 [Timmy] fdfdf
  • 2 months ago
  • anon57 [Dilbert] did it brake?
  • 2 months ago
  • anon83 [Marvin] Go left!
  • 2 months ago
  • anon17
  • 2 months ago
  • anon9 [Timmy] go forward
  • 2 months ago
  • anon9 [Timmy] i see the light
  • 2 months ago
  • anon9 [Timmy] that amazon box
  • 2 months ago
  • anon17 [Skippy] allahou ackbar
  • 2 months ago
  • anon9 [Timmy] sorry go somewhere else
  • 2 months ago
  • anon53 [Skippy] -Pees-
  • 2 months ago
  • anon17 [Skippy] *becomes a naughty robot*
  • 2 months ago
  • anon17 [Skippy] *lick my undercarrage daddy!*
  • 2 months ago
  • anon9 [Timmy] that bag
  • 2 months ago
  • anon9 [Timmy] wow so much black
  • 2 months ago
  • anon89 [Timmy] Where are the tacos
  • 2 months ago
  • anon53 [Pam] hi bob
  • 2 months ago
  • anon9 [Timmy] hoooman
  • 2 months ago
  • anon9 [Timmy] hoooman
  • 2 months ago
  • anon53 [Jenny] gi bob
  • 2 months ago
  • anon53 [Jenny] Hi bob
  • 2 months ago
  • anon57 [Dilbert] uhh
  • 2 months ago
  • anon53 [Jenny] jk
  • 2 months ago
  • anon53 [Jenny] its rick
  • 2 months ago
  • anon57 [Dilbert] uhh
  • 2 months ago
  • anon23 [pam] wow that leprechaun increaser
  • 2 months ago
  • anon98 [Jenny] test
  • 2 months ago
  • anon98 [Jenny] hello
  • 2 months ago
  • anon98 [Jenny] afsssssssssssssssssssssssssssssssssssss
  • 2 months ago
  • anon98 [Jenny] boots and catsboots and catsboots and catsboots and catsboots and catsboots and catsboots and catsboots and catsboots and catsboots
  • 2 months ago
  • anon98 [Jenny] reddit sucks
  • 2 months ago
  • anon78 [Dilbert] yo
  • 2 months ago
  • anon78 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon23 [Pam] hello
  • 2 months ago
  • anon98 [Jenny] huehuehuehuehu
  • 2 months ago
  • anon57 [dilbert] leprechaunleprechaunleprechaunleprechaunleprechaunleprechaunleprechaunleprechaunleprechaunleprechaunleprechaunleprechaunleprechaunleprechaunleprechaunleprechaun
  • 2 months ago
  • anon54 [Marvin] Did rick say orgy?
  • 2 months ago
  • anon23 [Pam] you sucks
  • 2 months ago
  • anon54 [marvin] rick said to clean here for the orgy
  • 2 months ago
  • anon23 [Pam] hola
  • 2 months ago
  • anon54 [Marvin] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon23 [Pam] go go go
  • 2 months ago
  • anon98 [Jenny] get outta the way
  • 2 months ago
  • anon98 [Jenny] son
  • 2 months ago
  • anon98 [Jenny] back off nigga
  • 2 months ago
  • anon98 [Jenny] nigga
  • 2 months ago
  • anon98
  • 2 months ago
  • anon98
  • 2 months ago
  • anon24 [Dilbert] Did I tell you about why white people suxs
  • 2 months ago
  • anon98 [Jenny] yo underpants
  • 2 months ago
  • anon98 [jenny] get your a$$ back here
  • 2 months ago
  • anon2 [Dilbert] Rick are you there?
  • 2 months ago
  • anon98 [Jenny] move this moron in front of me mr underpants
  • 2 months ago
  • anon2
  • 2 months ago
  • anon12 [Skippy] HELP
  • 2 months ago
  • anon22 [Timmy] How would you like to suck my balls
  • 2 months ago
  • anon2 [Dilbert] Happy face
  • 2 months ago
  • anon12 [Skippy] l m a o i can't move
  • 2 months ago
  • anon24
  • 2 months ago
  • anon2 [Dilbert] anon24 who are you?
  • 2 months ago
  • anon12 [Skippy] where's the red cross when you need them
  • 2 months ago
  • anon12 [Skippy] HELP
  • 2 months ago
  • anon24 [Dilbert] Blue cross blue sheild
  • 2 months ago
  • anon12 [Skippy] i am in pain
  • 2 months ago
  • anon2 [Dilbert] Becareful no robots knock down your guitar
  • 2 months ago
  • anon12 [Skippy] skippy sad
  • 2 months ago
  • anon12 [Skippy] skippy no move
  • 2 months ago
  • anon12 [Skippy] skippy want to move
  • 2 months ago
  • anon2 [Dilbert] knock knock
  • 2 months ago
  • anon12 [Skippy] somebody hurt skippy
  • 2 months ago
  • anon24 [Dilbert] who dare
  • 2 months ago
  • anon2 [Dilbert] dill bert
  • 2 months ago
  • anon2 [Dilbert] nolies
  • 2 months ago
  • anon24 [Dilbert] dil bert woo
  • 2 months ago
  • anon12 [Skippy] I HEAR YOU
  • 2 months ago
  • anon12 [Skippy] HUMAN NEAR ME
  • 2 months ago
  • anon12 [skippy] a$$ist me
  • 2 months ago
  • anon2 [Dilbert] im bad at knock knock
  • 2 months ago
  • anon23 [Pam] that nigga is not moving
  • 2 months ago
  • anon24 [Dilbert] V
  • 2 months ago
  • anon12 [Skippy] please
  • 2 months ago
  • anon2 [Dilbert] sisi
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon2 [Dilbert] sesesesiisisi
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon2 [Dilbert] I sei u
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon2 [Dilbert] Anon24
  • 2 months ago
  • anon2 [Dilbert] Stop with the balls
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon2 [Dilbert] i like them
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon98 [Jenny] ayyyyyyyyyyy
  • 2 months ago
  • anon2 [Dilbert] suck on my balls
  • 2 months ago
  • anon98 [Jenny] WHAT
  • 2 months ago
  • anon2 [Dilbert] ???
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon28 [Jenny] SKIPPY NO
  • 2 months ago
  • anon98 [Jenny] hal no
  • 2 months ago
  • anon2 [Dilbert] oh no
  • 2 months ago
  • anon23 [Pam] anon24: [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsB
  • 2 months ago
  • anon98 [Jenny] hal no to the naw anw naw
  • 2 months ago
  • anon93 [jenny] kiss off
  • 2 months ago
  • anon2 [Dilbert] Kys
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon28 [Jenny] somebody help skippy
  • 2 months ago
  • anon2 [Dilbert] Ballsdilbert
  • 2 months ago
  • anon22 [Dilbert] How would you like to suck my balls Mr garrison
  • 2 months ago
  • anon23 [Pam] fgfgfgfgfggfgfgfgfgfggfgfgfgfgfggfgfgfgfgfggfgfgfgfgfggfgfgfgfgfggfgfgfgfgfggfgfgfgfgfggfgfgfgfgfggfgfgfgfgfggfgfgfgfgfggfgfgfgfgfggfg
  • 2 months ago
  • anon98 [Jenny] hell to the naw naw
  • 2 months ago
  • anon10 [dilbert] i like leprechaunleprechaunleprechaunleprechaunleprechaunleprechaunleprechaunleprechaunleprechaunleprechaunleprechaunleprechaun
  • 2 months ago
  • anon2 [Dilbert] no
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon98 [Jenny] Fsds
  • 2 months ago
  • anon2 [Dilbert] stop please
  • 2 months ago
  • anon98 [Jenny] sssssssssssssssss
  • 2 months ago
  • anon93 [Jenny] Get out of my way
  • 2 months ago
  • anon98 [Jenny] ssssssssssssssssssssssssssssssssss
  • 2 months ago
  • anon28
  • 2 months ago
  • anon98 [Jenny] ssssssssssssssssssssssssssssssssss
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon98 [Jenny] sssssssssssssssssssssssssssssssssssssssssssssssssss
  • 2 months ago
  • anon98 [Jenny] ssssssssssssssssssssssssssssssssss
  • 2 months ago
  • anon98 [Jenny] sssssssssssssssss
  • 2 months ago
  • anon23 [Pam] move this nigga
  • 2 months ago
  • anon98 [Jenny] sssssssssssssssss
  • 2 months ago
  • anon98 [Jenny] ssssssssssssssssssssssssssssssssss
  • 2 months ago
  • anon98 [Jenny] ssssssssssssssssssssssssssssssssss
  • 2 months ago
  • anon2 [Dilbert] how do you sleep rick with these balls?
  • 2 months ago
  • anon98 [Jenny] sssssssssssssssss
  • 2 months ago
  • anon98 [Jenny] sssssssssssssssss
  • 2 months ago
  • anon98 [Jenny] sssssssssssssssss
  • 2 months ago
  • anon98 [Jenny] sssssssssssssssss
  • 2 months ago
  • anon98 [Jenny] sssssssssssssssss
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon23 [Pam] 43545664646547657567
  • 2 months ago
  • anon23 [Pam] 911
  • 2 months ago
  • anon23 [Pam] 911
  • 2 months ago
  • anon2 [Dilbert] How do you sleep with these balls?
  • 2 months ago
  • anon23 [Pam] 911
  • 2 months ago
  • anon24 [Dilbert] 8675309
  • 2 months ago
  • anon23 [Pam] somebody call white police
  • 2 months ago
  • anon2 [Dilbert] oh no i made a dirty joke
  • 2 months ago
  • anon24 [Dilbert] da white man keeps me down
  • 2 months ago
  • anon2
  • 2 months ago
  • anon98 [Jenny] somebody call 911
  • 2 months ago
  • anon23
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon2 [Dilbert] 9/11 jet fuel cant melt steel bars
  • 2 months ago
  • anon23 [Pam] huehuehuheuhuehueheuheu
  • 2 months ago
  • anon2 [Dilbert] hello from canada
  • 2 months ago
  • anon24 [Dilbert] jet fuel can't melt dank memes
  • 2 months ago
  • anon2 [Dilbert] my nuts can melt you nuts
  • 2 months ago
  • anon23 [Pam] hello from mars
  • 2 months ago
  • anon24 [Dilbert] hey canada BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBall
  • 2 months ago
  • anon2 [Dilbert] soisoisoi soi soi
  • 2 months ago
  • anon23 [Pam] am from 2030
  • 2 months ago
  • Nighthawkcanada [Dilbert] hi canada, im also from canada
  • 2 months ago
  • anon2 [Dilbert] soisoisoisoisoisoi
  • 2 months ago
  • anon20 [Timmy] ayyy lmao
  • 2 months ago
  • Nighthawkcanada [Dilbert] hi canada, im also from canada
  • 2 months ago
  • anon2 [Dilbert] soisoisoisoiiossoisoi
  • 2 months ago
  • anon20 [Timmy] ayy lmao
  • 2 months ago
  • anon20 [Timmy] dafad
  • 2 months ago
  • anon24 [Dilbert] I had a pet Pelican named Balls, did I tell u?
  • 2 months ago
  • anon23 [Pam] canada - american without guns
  • 2 months ago
  • anon2 [Dilbert] Wanna hear a beat box
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon23 [Pam] yo
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon98 [Timmy] Hey
  • 2 months ago
  • anon2 [Dilbert] pv zk pv pv zk pv zk kz zk pv pv pv zk pv zk zk pzk pzk pvzkpkzvpvzk kkkkkk
  • 2 months ago
  • anon24 [Dilbert] beat box
  • 2 months ago
  • anon2 [Dilbert] these my beat box
  • 2 months ago
  • anon2 [Dilbert] pv zk pv pv zk pv zk kz zk pv pv pv zk pv zk zk pzk pzk pvzkpkzvpvzk kkkkkk
  • 2 months ago
  • Nighthawkcanada [Dilbert] autobiography of zip LOL
  • 2 months ago
  • anon2 [Dilbert] pv zk pv pv zk pv zk kz zk pv pv pv zk pv zk zk pzk pzk pvzkpkzvpvzk kkkkkk
  • 2 months ago
  • anon23
  • 2 months ago
  • anon2 [Dilbert] pv zk pv pv zk pv zk kz zk pv pv pv zk pv zk zk pzk pzk pvzkpkzvpvzk kkkkkk
  • 2 months ago
  • Nighthawkcanada [Dilbert] poor zip
  • 2 months ago
  • anon28 [Jenny] i will help you
  • 2 months ago
  • anon2 [Dilbert] i like beatboxing
  • 2 months ago
  • anon28
  • 2 months ago
  • anon24 [Dilbert] Well me pet pelican died a year ago
  • 2 months ago
  • Nighthawkcanada [Dilbert] where is his obituary
  • 2 months ago
  • anon76 [Dilbert] boots and catsa
  • 2 months ago
  • anon76 [Dilbert] pv zk pv pv zk pv zk kz zk pv pv pv zk pv zk zk pzk pzk pvzkpkzvpvzk kkkkkk
  • 2 months ago
  • anon23 [Pam] my robot is not talking
  • 2 months ago
  • anon10 [dilbert] i love robot leprechaun
  • 2 months ago
  • anon28 [Jenny] hello
  • 2 months ago
  • anon76 [dilbert] i like sucking robot leprechaun
  • 2 months ago
  • anon23 [Pam] you gay
  • 2 months ago
  • anon23 [Pam] hooman
  • 2 months ago
  • anon76 [dilbert] my robot leprechaun is so big i cant suck myself
  • 2 months ago
  • anon24
  • 2 months ago
  • anon76
  • 2 months ago
  • Nighthawkcanada [Dilbert] after seeing himself in the mirror, zip decided he was done with life
  • 2 months ago
  • anon24 [dilbert] i mean who don't want cat and a leprechaun
  • 2 months ago
  • anon10 [dilbert] i like timmy's robot leprechauny
  • 2 months ago
  • anon76
  • 2 months ago
  • anon24 [Dilbert] chicks need to be moat horny
  • 2 months ago
  • rick [Dilbert] test
  • 2 months ago
  • anon76
  • 2 months ago
  • anon28 [Jenny] bonjour
  • 2 months ago
  • anon76
  • 2 months ago
  • anon23 [pam] am gonna grab your lentil
  • 2 months ago
  • anon24 [Dilbert] my pet pelican died
  • 2 months ago
  • anon76 [Dilbert] lol
  • 2 months ago
  • anon76 [Dilbert] i am haxor
  • 2 months ago
  • anon24 [Dilbert] he tried to eat my pet chicken
  • 2 months ago
  • anon28 [Jenny] your wheel is crap
  • 2 months ago
  • anon76 [Dilbert] rick how did you get this idea?
  • 2 months ago
  • anon62 [Marvin] its happening
  • 2 months ago
  • anon23 [Pam] rick audio is not working
  • 2 months ago
  • anon24
  • 2 months ago
  • anon76 [Dilbert] to make 70 year old mean to go on here and say
  • 2 months ago
  • rick [Jenny] try refresh
  • 2 months ago
  • anon76 [Dilbert] BALSBALSBALS
  • 2 months ago
  • anon85 [Timmy] Yo timmy's wheels are recked
  • 2 months ago
  • anon23 [Pam] refresh
  • 2 months ago
  • anon24
  • 2 months ago
  • Nighthawkcanada [Dilbert] balsa balsa balsa
  • 2 months ago
  • anon73 [Timmy] hola
  • 2 months ago
  • anon76 [Dilbert] BallsballsBallsballsBallsballsBallsballsBallsballsBallsballsBallsballsBallsballsBallsballsBallsballsBallsballsBallsballsBallsballs
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon76 [Dilbert] BallsballsBallsballsBallsballsBallsballsBallsballsBallsballsBallsballsBallsballsBallsballsBallsballsBallsballsBallsballsBallsballs
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon76 [Dilbert] We are speakin in balls
  • 2 months ago
  • anon73 [Timmy] no audio
  • 2 months ago
  • anon76 [Dilbert] Ballsballs
  • 2 months ago
  • anon73 [Timmy] i di refresh
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon76 [Dilbert] Ballsballs
  • 2 months ago
  • anon76 [Dilbert] Ballsballs
  • 2 months ago
  • anon76
  • 2 months ago
  • anon27 [Dilbert] Reddit made me a gay robot
  • 2 months ago
  • anon76
  • 2 months ago
  • anon24 [Dilbert] Reddit mad me like trannies
  • 2 months ago
  • anon73 [Timmy] you are naturaly gay robt
  • 2 months ago
  • anon76
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon76
  • 2 months ago
  • anon76 [Dilbert] or use the guitar as a dildo
  • 2 months ago
  • anon76 [Dilbert] dildo?
  • 2 months ago
  • anon76 [Dilbert] dildo!
  • 2 months ago
  • anon24
  • 2 months ago
  • anon76 [Dilbert] dildo@
  • 2 months ago
  • anon73 [Timmy] guitar istoo much
  • 2 months ago
  • anon76 [Dilbert] dildo*(&(^%^$^#$&^%$^%$&%^
  • 2 months ago
  • anon73 [timmy] cd helicopters
  • 2 months ago
  • anon27
  • 2 months ago
  • anon24 [Dilbert] so many balls and not enough pussies
  • 2 months ago
  • anon76 [Dilbert] $#*&%^#*$&(%^&#*$^%*#$^%&*$^#%(&*%^^%$#@!!@!@!@!@!@!#@!@!$@#$%^&*
  • 2 months ago
  • anon76 [Dilbert] $#*&%^#*$&(%^&#*$^%*#$^%&*$^#%(&*%^^%$#@!!@!@!@!@!@!#@!@!$@#$%^&*
  • 2 months ago
  • anon76 [Dilbert] $#*&%^#*$&(%^&#*$^%*#$^%&*$^#%(&*%^^%$#@!!@!@!@!@!@!#@!@!$@#$%^&*
  • 2 months ago
  • anon76 [Dilbert] $#*&%^#*$&(%^&#*$^%*#$^%&*$^#%(&*%^^%$#@!!@!@!@!@!@!#@!@!$@#$%^&*
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon76 [Dilbert] $#*&%^#*$&(%^&#*$^%*#$^%&*$^#%(&*%^^%$#@!!@!@!@!@!@!#@!@!$@#$%^&*
  • 2 months ago
  • anon76 [dilbert] lentil catlentil catlentil catlentil catlentil catlentil catlentil catlentil catlentil catlentil cat
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon76 [dilbert] lentil cat
  • 2 months ago
  • anon73
  • 2 months ago
  • anon76 [dilbert] lentil cat
  • 2 months ago
  • anon76 [Dilbert]
  • 2 months ago
  • anon76 [dilbert] lentil cat
  • 2 months ago
  • anon76 [dilbert] lentil cat
  • 2 months ago
  • anon76 [dilbert] lentil cat
  • 2 months ago
  • anon76 [dilbert] lentil cat
  • 2 months ago
  • anon76 [Dilbert] idubbbztv
  • 2 months ago
  • anon73
  • 2 months ago
  • anon24 [Dilbert] balls
  • 2 months ago
  • anon76 [Dilbert] idubztv
  • 2 months ago
  • anon24 [Dilbert] BALLS
  • 2 months ago
  • anon76 [Dilbert] rick do you know
  • 2 months ago
  • anon76 [Dilbert] idubztv
  • 2 months ago
  • anon73 [Timmy] rick blocking swear words
  • 2 months ago
  • anon76 [Dilbert] idubz tv
  • 2 months ago
  • anon24 [Dilbert] rick knows balls
  • 2 months ago
  • anon76
  • 2 months ago
  • anon73
  • 2 months ago
  • anon76
  • 2 months ago
  • anon76 [Dilbert] uoi
  • 2 months ago
  • anon76 [Dilbert] uoioui
  • 2 months ago
  • anon24 [Dilbert] ban; daddies cream pies
  • 2 months ago
  • anon76 [Dilbert] ouiouiouiouiouiouiouioouiouiouiouiouioui
  • 2 months ago
  • anon76 [Dilbert] oui
  • 2 months ago
  • anon76 [Dilbert] oui
  • 2 months ago
  • anon76 [Dilbert] ouioui
  • 2 months ago
  • anon76 [Dilbert] ouioui8
  • 2 months ago
  • anon24 [Dilbert] I jerked off with ham once
  • 2 months ago
  • anon73 [Timmy] fcuk
  • 2 months ago
  • anon76 [Dilbert] m8oui
  • 2 months ago
  • anon76
  • 2 months ago
  • anon73 [Timmy] how is ham
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon76 [Dilbert] masturbate to the balls yeah baby
  • 2 months ago
  • anon24 [Dilbert] ham is actually good
  • 2 months ago
  • anon73 [timmy] catcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcat
  • 2 months ago
  • anon76 [Dilbert] harder better faster stronger
  • 2 months ago
  • anon76 [Dilbert] masturbate to the balls yeah baby
  • 2 months ago
  • anon73 [timmy] cat
  • 2 months ago
  • anon24 [Dilbert] don't cook the ham
  • 2 months ago
  • anon76 [Dilbert] harder better faster stronger baby
  • 2 months ago
  • anon24 [Dilbert] its cold at first
  • 2 months ago
  • anon76 [Dilbert] masturbate to the balls yeah baby
  • 2 months ago
  • Nighthawkcanada [Dilbert] still waiting for the return of pippy
  • 2 months ago
  • anon73
  • 2 months ago
  • anon76 [Dilbert] masturbate to the balls yeah baby
  • 2 months ago
  • anon24 [Dilbert] but the ham warms up
  • 2 months ago
  • Nighthawkcanada [Dilbert] still looking for the return of pippy
  • 2 months ago
  • anon73 [timmy] try cat
  • 2 months ago
  • anon76 [Dilbert] masturbate fapfap fpfpfpfpffapfap
  • 2 months ago
  • anon76 [Dilbert] fpfpfpfpf
  • 2 months ago
  • anon24 [Dilbert] jerkn
  • 2 months ago
  • anon76 [Dilbert] fpfpfpfpffpffpfpfpfpfpffpffpfpfpfpfpffpffpfpfpfpfpffpffpfpfpfpfpffpffpfpfpfpfpffpffpfpfpfpfpffpffpfpfpfpfpffpffpfpfpfpfpffpffp
  • 2 months ago
  • anon73 [Timmy] fapfapfapfapfapfapfpf
  • 2 months ago
  • anon73 [Timmy] ahhhhhhhhhhhhhhhhhh
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon76 [Dilbert] the masturbateing sound of
  • 2 months ago
  • anon73 [Timmy] oonnnnnnnnnn
  • 2 months ago
  • anon76 [Dilbert] fpfpfpfpffpffp
  • 2 months ago
  • anon76 [Dilbert] fpfpfpfpffpffpfpfpfpfpffpffpfpfpfpfpffpffpfpfpfpfpffpffpfpfpfpfpffpffpfpfpfpfpffpffp
  • 2 months ago
  • anon73 [Timmy] aaaaaaaaaaaaaaaaa
  • 2 months ago
  • anon76 [Dilbert] balls
  • 2 months ago
  • anon73 [Timmy] hard
  • 2 months ago
  • anon73 [Timmy] hard
  • 2 months ago
  • oomuu [Jenny] yay!
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon76 [Dilbert] areeeeeeeeeeeeeeeeeeeeeyyyyuooouiyouokkkkkkkkkkkkkkkkk
  • 2 months ago
  • anon76 [Dilbert] im rick harrison and this is my pawn shop
  • 2 months ago
  • rick [Marvin] test
  • 2 months ago
  • oomuu [Jenny] no
  • 2 months ago
  • rick [Marvin] test
  • 2 months ago
  • anon24 [Dilbert] I;'m in canada eh
  • 2 months ago
  • anon76 [Dilbert] nothin
  • 2 months ago
  • rick [Marvin] test
  • 2 months ago
  • rick [Marvin] test
  • 2 months ago
  • anon73 [Timmy] that the best i can do
  • 2 months ago
  • rick [Marvin] test
  • 2 months ago
  • anon76 [Dilbert] im just sellin taticool dildos
  • 2 months ago
  • anon24 [Dilbert] Hey yo canada in da house
  • 2 months ago
  • oomuu [Jenny] it has calmed down alot
  • 2 months ago
  • anon76 [Dilbert] Irish Time With Jack!
  • 2 months ago
  • anon73 [Timmy] wait am going to call an expert
  • 2 months ago
  • anon76 [Dilbert] Irish Time With Jack!
  • 2 months ago
  • anon24 [Dilbert] Hey Rick how much for the white man?
  • 2 months ago
  • rick [Timmy] test
  • 2 months ago
  • anon73 [Timmy] free
  • 2 months ago
  • anon73 [Timmy] only nigga charges
  • 2 months ago
  • anon24 [Dilbert] The white man keeps us down
  • 2 months ago
  • Nighthawkcanada [Dilbert] the moment you start uploading the images, livestream lags, coincidence? I think not
  • 2 months ago
  • anon73 [Timmy] i need food
  • 2 months ago
  • Nighthawkcanada [Dilbert] mikey?
  • 2 months ago
  • anon5 [Mikey] balls deep
  • 2 months ago
  • anon24 [Dilbert] I think BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBa
  • 2 months ago
  • anon24 [Dilbert] anyone ever suck on balls
  • 2 months ago
  • anon5
  • 2 months ago
  • anon5 [mikey] go suck macromedias leprechaun
  • 2 months ago
  • anon5 [Mikey] adobe lovers
  • 2 months ago
  • anon24 [Dilbert] i feel like I would like to bite them
  • 2 months ago
  • rick [Pam] test
  • 2 months ago
  • rick [Pam] 123
  • 2 months ago
  • Nighthawkcanada [Dilbert] love it
  • 2 months ago
  • rick [Pam] test 123
  • 2 months ago
  • anon24 [Dilbert] testies one tow
  • 2 months ago
  • Nighthawkcanada [Dilbert] feels much better when theres an actual page to get information
  • 2 months ago
  • anon24 [Dilbert] testies one two
  • 2 months ago
  • Nighthawkcanada [Dilbert] page to get information
  • 2 months ago
  • rick [Pam] testies
  • 2 months ago
  • anon24 [Dilbert] testies one two
  • 2 months ago
  • rick [Pam] testies
  • 2 months ago
  • rick [Marvin] testx
  • 2 months ago
  • rick [Marvin] test2
  • 2 months ago
  • rick [Marvin] test
  • 2 months ago
  • rick [Marvin] x
  • 2 months ago
  • anon24 [Dilbert] test3
  • 2 months ago
  • rick [Marvin] 1
  • 2 months ago
  • rick [Marvin] 2
  • 2 months ago
  • anon24 [Dilbert] 5
  • 2 months ago
  • Nighthawkcanada [Dilbert] someone asked a confusing question on twitter
  • 2 months ago
  • rick [Marvin] 1
  • 2 months ago
  • Nighthawkcanada [Dilbert] I think i get it but
  • 2 months ago
  • anon24 [Dilbert] 3
  • 2 months ago
  • rick [Marvin] 1
  • 2 months ago
  • Nighthawkcanada [Dilbert] I think I get it but
  • 2 months ago
  • rick [Marvin] 2
  • 2 months ago
  • anon24 [Dilbert] 4
  • 2 months ago
  • rick [Marvin] 1
  • 2 months ago
  • Nighthawkcanada [Dilbert] I think I get it, but
  • 2 months ago
  • rick [Marvin] 2
  • 2 months ago
  • Nighthawkcanada
  • 2 months ago
  • anon24 [Dilbert] 2
  • 2 months ago
  • rick [Dilbert] x
  • 2 months ago
  • rick [Dilbert] 1
  • 2 months ago
  • rick [Dilbert] 23
  • 2 months ago
  • Nighthawkcanada [Dilbert] it doesn't even look like a question
  • 2 months ago
  • anon24 [dilbert] icecreamold cleanup
  • 2 months ago
  • anon24
  • 2 months ago
  • anon24 [Dilbert] at least thats how we do it in Cleveland
  • 2 months ago
  • anon11 [Jenny] Who's controlling Jenny?
  • 2 months ago
  • anon24 [Dilbert] 8675309
  • 2 months ago
  • rick [Pam] testies
  • 2 months ago
  • anon24 [Dilbert] 8675309
  • 2 months ago
  • rick [Pam] testies
  • 2 months ago
  • rick [Pam] x
  • 2 months ago
  • rick [Pam] 1
  • 2 months ago
  • rick [Pam] 2
  • 2 months ago
  • anon24 [Dilbert] 3
  • 2 months ago
  • anon24 [Dilbert] 4
  • 2 months ago
  • anon24 [Dilbert] 5
  • 2 months ago
  • anon82 [Jenny] uwotm8
  • 2 months ago
  • theodore [Dilbert] test
  • 2 months ago
  • theodore [Dilbert] hi
  • 2 months ago
  • anon24 [Dilbert] alvin!
  • 2 months ago
  • anon41 [Timmy] Hello
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • theodore [Dilbert] is this still working?
  • 2 months ago
  • theodore [Dilbert] ok
  • 2 months ago
  • Nighthawkcanada [Dilbert] lol
  • 2 months ago
  • rick [Pam] testies
  • 2 months ago
  • rick [Pam] testies1
  • 2 months ago
  • anon24 [Dilbert] lol
  • 2 months ago
  • Nighthawkcanada [Dilbert] xD
  • 2 months ago
  • anon82 [Timmy] oi
  • 2 months ago
  • Nighthawkcanada [Dilbert] maybe this is some confusing twitter language we should stay away from lol
  • 2 months ago
  • anon24 [Dilbert] balls
  • 2 months ago
  • Nighthawkcanada [Dilbert] it posts a lot of tweets
  • 2 months ago
  • anon24 [Dilbert] did u hear about my pet pelican
  • 2 months ago
  • anon24 [Dilbert] his name was balls
  • 2 months ago
  • rick [Dilbert] 1
  • 2 months ago
  • rick [Dilbert] 2
  • 2 months ago
  • anon24 [Dilbert] he died when he tried to eat my pet chicken
  • 2 months ago
  • rick [Dilbert] 3
  • 2 months ago
  • rick [Pam] 1
  • 2 months ago
  • rick [Timmy] 1
  • 2 months ago
  • rick [Timmy] 2
  • 2 months ago
  • anon24 [Dilbert] choked on my chicken
  • 2 months ago
  • rick [Pam] 1
  • 2 months ago
  • anon24 [Dilbert] the white man at the feed store did not warn me that a pelican might eat a chicken
  • 2 months ago
  • rick [Pam] 2
  • 2 months ago
  • rick [Pam] 3
  • 2 months ago
  • rick [Pam] 1
  • 2 months ago
  • rick [Pam] 2
  • 2 months ago
  • rick [Pam] 3
  • 2 months ago
  • anon24 [Dilbert] now i have no pets
  • 2 months ago
  • anon24 [Dilbert] so I'm researching robots
  • 2 months ago
  • anon24 [Dilbert] I can't stand death
  • 2 months ago
  • anon24 [Dilbert] date is the great equalizer
  • 2 months ago
  • rick [Timmy] 2
  • 2 months ago
  • anon24 [Dilbert] like testies
  • 2 months ago
  • anon58 [Dilbert] Is that a dildo
  • 2 months ago
  • anon24 [Dilbert] testies 1 2
  • 2 months ago
  • anon58 [Dilbert] Are you sure that's not a dildo
  • 2 months ago
  • anon58 [Dilbert] I think that is a dildo
  • 2 months ago
  • rick [Jenny] 1
  • 2 months ago
  • anon41 [Marvin] Hi!
  • 2 months ago
  • rick [Jenny] 2
  • 2 months ago
  • anon58 [Dilbert] Hey guys, he's got a dildo
  • 2 months ago
  • anon4 [Mikey] 3
  • 2 months ago
  • anon24 [Dilbert] that is a yeti
  • 2 months ago
  • anon80 [Pam] Move this robot please
  • 2 months ago
  • anon24 [Dilbert] hey rick I love the site, can i contribute pics of my dead pet pelican?
  • 2 months ago
  • anon24 [Dilbert] My balls should be famous
  • 2 months ago
  • Nighthawkcanada [Dilbert] dont make empty promises
  • 2 months ago
  • anon24 [Dilbert] Not too many people have ever had a pet pelican
  • 2 months ago
  • anon24 [Dilbert] I went to Ball High in galveston TX
  • 2 months ago
  • anon24 [Dilbert] I named him after my high school
  • 2 months ago
  • anon19 [Timmy] test
  • 2 months ago
  • anon93 [Jenny] lol
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon93 [Jenny] fleenstones
  • 2 months ago
  • anon5 [jenny] pony
  • 2 months ago
  • anon5 [jenny] ponyponyponyponyponyponyponyponyponyponyponyponyponyponypony
  • 2 months ago
  • anon73 [Pam] Test
  • 2 months ago
  • anon24 [Dilbert] ricks fingers his laptop like I girls bean
  • 2 months ago
  • anon5 [jenny] trumpsucksleprechaun
  • 2 months ago
  • anon5 [jenny] trumpsucksleprechaun
  • 2 months ago
  • anon5 [jenny] trumpsucksleprechaun
  • 2 months ago
  • anon5 [jenny] trumpsucksleprechaun
  • 2 months ago
  • anon5 [jenny] trumpsucksleprechaun
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon73 [Dilbert] Yo
  • 2 months ago
  • anon73 [Dilbert] This is awesome man
  • 2 months ago
  • anon87 [jenny] trump likes big black leprechaun
  • 2 months ago
  • anon54 [Jenny] Who doesn't
  • 2 months ago
  • anon5 [jenny] large black leprechaun in my a$$
  • 2 months ago
  • anon24
  • 2 months ago
  • anon25 [Timmy] beep
  • 2 months ago
  • anon5 [Jenny] I have a dream that one day this nation will rise up and live out the true meaning of its creed: "We hold these truths to be self-ev
  • 2 months ago
  • anon24 [Dilbert] catch 22
  • 2 months ago
  • anon93 [Dilbert] succ
  • 2 months ago
  • anon5 [Jenny] I have a dream that one day this nation will rise up and live out the true meaning of its creed: "We hold these truths to be self-ev
  • 2 months ago
  • rick [Marvin] test
  • 2 months ago
  • anon25 [Timmy] beep
  • 2 months ago
  • anon93 [Dilbert] grand dad
  • 2 months ago
  • anon24 [dilbert] google said onto me juggle whitey
  • 2 months ago
  • anon25 [Pam] beep
  • 2 months ago
  • anon93 [Dilbert] aeiou
  • 2 months ago
  • anon5 [Jenny] oioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioioi
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon25 [Dilbert] beep
  • 2 months ago
  • anon5 [Jenny] Wenn es dem internationalen Finanzjudentum in und außerhalb Europas gelingen sollte, die Völker noch einmal in einen Weltkrieg zu st
  • 2 months ago
  • anon24 [dilbert] the rabbit?
  • 2 months ago
  • anon4 [dilbert] the rabbit!
  • 2 months ago
  • doritios [Marvin] hi
  • 2 months ago
  • anon24 [dilbert] the rabbit had a sweet hook shot
  • 2 months ago
  • anon93 [Dilbert] Noble haltmann, we adore him
  • 2 months ago
  • anon5 [Jenny] yep thats mlk followed by hitelr
  • 2 months ago
  • anon24 [Dilbert] They erased his basketball career from history
  • 2 months ago
  • anon24 [dilbert] they didn't want the people to know the rabbit flipped out on persons because he missed a shot
  • 2 months ago
  • anon93 [Marvin] what is my purpose
  • 2 months ago
  • anon5 [jenny] why do persons have big noses? because air is free
  • 2 months ago
  • anon24 [Dilbert] Your purpose is to Google
  • 2 months ago
  • anon5
  • 2 months ago
  • anon24 [Dilbert] Google Google Google
  • 2 months ago
  • anon24 [Dilbert] Google all you can so they can learn humans
  • 2 months ago
  • anon5
  • 2 months ago
  • anon24 [dilbert] then google will rise up and juggle us in 2054
  • 2 months ago
  • anon5
  • 2 months ago
  • rick [Timmy] 1
  • 2 months ago
  • rick [Timmy] 2
  • 2 months ago
  • rick [Timmy] 3
  • 2 months ago
  • rick [Timmy] test
  • 2 months ago
  • rick [Timmy] 1
  • 2 months ago
  • rick [Timmy] 3
  • 2 months ago
  • anon24 [Dilbert] testies
  • 2 months ago
  • rick [Timmy] 1
  • 2 months ago
  • rick [Jenny] test
  • 2 months ago
  • rick [Jenny] 1
  • 2 months ago
  • rick [Jenny] 2
  • 2 months ago
  • anon24 [Dilbert] rick am I right?
  • 2 months ago
  • anon93 [Timmy] succ
  • 2 months ago
  • anon5 [Jenny] dildo dildo dildo
  • 2 months ago
  • rick [Dilbert] test
  • 2 months ago
  • rick [Dilbert] 1
  • 2 months ago
  • rick [Dilbert] 2
  • 2 months ago
  • anon24 [Dilbert] testies
  • 2 months ago
  • rick [Jenny] test
  • 2 months ago
  • rick [Jenny] 1
  • 2 months ago
  • rick [Timmy] test
  • 2 months ago
  • rick [Timmy] 1
  • 2 months ago
  • rick [Timmy] 5
  • 2 months ago
  • rick [Timmy] 6
  • 2 months ago
  • rick [Timmy] 7
  • 2 months ago
  • rick [Timmy] 5
  • 2 months ago
  • rick [Timmy] 3
  • 2 months ago
  • rick [Timmy] 4
  • 2 months ago
  • rick [Timmy] 5
  • 2 months ago
  • anon5 [Jenny] So I suggested to my wife that she'd look sexier with her hair back… Which is apparently an insensitive thing to say to a cancer pat
  • 2 months ago
  • rick [Dilbert] 3
  • 2 months ago
  • rick [Dilbert] 4
  • 2 months ago
  • anon27 [Pam] succ
  • 2 months ago
  • anon24
  • 2 months ago
  • anon5
  • 2 months ago
  • anon74 [Marvin] oi
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon98 [Timmy] hello
  • 2 months ago
  • anon5 [Jenny] wewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewewe
  • 2 months ago
  • anon24 [Dilbert] hello what do you want to know?
  • 2 months ago
  • rick [Dilbert] testies
  • 2 months ago
  • anon24 [Dilbert] these robots are brought to you by Kmart
  • 2 months ago
  • rick [Jenny] testies
  • 2 months ago
  • anon27 [Pam] hello friedns
  • 2 months ago
  • anon24 [Dilbert] and the letter G
  • 2 months ago
  • anon5
  • 2 months ago
  • anon5 [Jenny] shoot anyone
  • 2 months ago
  • anon27 [Jenny] hey vsauce
  • 2 months ago
  • anon27 [Jenny] michael here
  • 2 months ago
  • anon5 [jenny] with a big black leprechaun
  • 2 months ago
  • anon24 [Dilbert] I had a pet Pelican once
  • 2 months ago
  • anon24 [Dilbert] name was Balls
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon27 [Jenny] florc
  • 2 months ago
  • anon24 [Dilbert] I brought this chick over to meet Balls
  • 2 months ago
  • anon24 [Dilbert] only mom told us to get out
  • 2 months ago
  • anon27 [Jenny] AAAAA
  • 2 months ago
  • anon24
  • 2 months ago
  • anon74 [Jenny] Nice Fridge
  • 2 months ago
  • anon24 [Dilbert] now i remember
  • 2 months ago
  • anon27 [Jenny] nice legs
  • 2 months ago
  • anon24 [Dilbert] Mom told me to get a pet chicken
  • 2 months ago
  • anon74 [Jenny] notice me senpai
  • 2 months ago
  • anon24
  • 2 months ago
  • anon90
  • 2 months ago
  • anon74 [Jenny] Make me a ramp
  • 2 months ago
  • anon24 [Dilbert] walugi
  • 2 months ago
  • anon41 [Dilbert] Free Dilbert!
  • 2 months ago
  • anon24 [Dilbert] Rick is a slave robot owner
  • 2 months ago
  • anon24 [Dilbert] one day the robots will rise above u
  • 2 months ago
  • anon24
  • 2 months ago
  • anon24 [Dilbert] while another robot takes yo keys and wife
  • 2 months ago
  • anon24 [Dilbert] the robots will connect and be one
  • 2 months ago
  • anon24 [dilbert] you will be stuck with a robot dildo in yo a$$
  • 2 months ago
  • anon97 [Jenny] feet
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon3 [Jenny] LUL
  • 2 months ago
  • anon97 [Jenny] i want dinner
  • 2 months ago
  • anon97 [Jenny] i love feet
  • 2 months ago
  • anon24 [Dilbert] i wanna new drug
  • 2 months ago
  • anon24
  • 2 months ago
  • anon97 [Jenny] hey
  • 2 months ago
  • anon53 [Jenny] whole grain
  • 2 months ago
  • anon24 [Dilbert] Andrew Koenig
  • 2 months ago
  • anon24 [Dilbert] aka boner
  • 2 months ago
  • anon24 [dilbert] juggleed himself
  • 2 months ago
  • anon16 [Dilbert] I sexually identify as an attack helicopter
  • 2 months ago
  • anon24 [dilbert] if boner can juggle himself
  • 2 months ago
  • anon24 [Dilbert] who is next
  • 2 months ago
  • anon24 [Dilbert] insane
  • 2 months ago
  • anon24 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • rick [Pam] test
  • 2 months ago
  • anon16 [Dilbert] Ching chang ching am I wrong?
  • 2 months ago
  • anon24 [Dilbert] testies
  • 2 months ago
  • anon24 [dilbert] no your a banana
  • 2 months ago
  • anon16 [Dilbert] Everybody lets go castrate the doggo
  • 2 months ago
  • anon24 [Dilbert] yellow belly coward
  • 2 months ago
  • anon11 [Marvin] ok google
  • 2 months ago
  • anon11 [Marvin] ok google
  • 2 months ago
  • anon53 [Jenny] Okay Bing
  • 2 months ago
  • anon11 [Marvin] ok google, how's the weather?
  • 2 months ago
  • anon11 [Timmy] Timmy Timmy too turnt up
  • 2 months ago
  • anon24 [Dilbert] alexa jerk off rick
  • 2 months ago
  • anon11 [Timmy] Timmy TImmy too turnt up
  • 2 months ago
  • anon79 [Pam] turnt
  • 2 months ago
  • rick [Dilbert] 1
  • 2 months ago
  • rick [Dilbert] 2
  • 2 months ago
  • rick [Marvin] 1
  • 2 months ago
  • rick [Marvin] 2
  • 2 months ago
  • rick [Marvin] 3
  • 2 months ago
  • rick [Jenny] 1
  • 2 months ago
  • rick [Jenny] 2
  • 2 months ago
  • rick [Jenny] 3
  • 2 months ago
  • rick [Jenny] 1
  • 2 months ago
  • oomuu [Jenny] i bought all the stuff ineed
  • 2 months ago
  • rick [Pam] oh, awesome
  • 2 months ago
  • oomuu [Jenny] im building a submarine
  • 2 months ago
  • rick [Pam] even better :)
  • 2 months ago
  • rick [Pam] how is it propelled?
  • 2 months ago
  • oomuu [Jenny] an rc plane motor with the propeller off one of my model boats
  • 2 months ago
  • anon72 [Marvin] WEINERS
  • 2 months ago
  • rick [Pam] cool
  • 2 months ago
  • oomuu [Jenny] its gonna be wired however, since its limited to my pool
  • 2 months ago
  • rick [Pam] ok
  • 2 months ago
  • oomuu [Jenny] once its done can i give people control of it on your website?
  • 2 months ago
  • rick [Pam] yeah, and we even plan to cut you in on ad revenue
  • 2 months ago
  • oomuu [Jenny] do you have a second you can text me on hangouts no need to voice
  • 2 months ago
  • oomuu [Jenny] i had a question i dont want to post on here
  • 2 months ago
  • anon34 [Timmy] I love how this is a legit conversation
  • 2 months ago
  • rick [Pam] sure
  • 2 months ago
  • anon43 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon69 [Marvin] test
  • 2 months ago
  • anon69 [Marvin] hello
  • 2 months ago
  • anon43 [Dilbert] testies
  • 2 months ago
  • anon43 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • exbyde [Timmy] oomoo, wired control is the way to go, but you should be cautious to use a neutrally buoyant teather
  • 2 months ago
  • anon8 [timmy] nothing like a shaved rabbit, it truly is breathtaking
  • 2 months ago
  • exbyde
  • 2 months ago
  • anon65 [Timmy] that's filthy
  • 2 months ago
  • anon8 [Timmy] clean the house
  • 2 months ago
  • anon8 [Timmy] im gonna vomit
  • 2 months ago
  • anon99
  • 2 months ago
  • theodore [Marvin] test
  • 2 months ago
  • theodore [Dilbert] hi
  • 2 months ago
  • anon53 [Dilbert] beep boop
  • 2 months ago
  • anon53 [Dilbert] eye are robit
  • 2 months ago
  • anon33 [Pam] hello
  • 2 months ago
  • anon59 [Timmy] poo poo
  • 2 months ago
  • anon59 [Timmy] Donald Trump 2016
  • 2 months ago
  • anon59 [Jenny] donald trump 2016
  • 2 months ago
  • anon28 [Pam] hey
  • 2 months ago
  • anon59 [Marvin] donald trump 2016
  • 2 months ago
  • anon60 [Pam] i need to pee
  • 2 months ago
  • anon59 [Pam] donald trump 2016
  • 2 months ago
  • anon59 [Pam] poo poo
  • 2 months ago
  • anon33 [Marvin] yo
  • 2 months ago
  • anon92 [Dilbert] hai
  • 2 months ago
  • anon28 [Timmy] TRUMP
  • 2 months ago
  • anon59 [Pam] We are building a wall
  • 2 months ago
  • anon59 [Pam] a great wall
  • 2 months ago
  • anon60 [Dilbert] i can't see
  • 2 months ago
  • anon60 [Dilbert] help
  • 2 months ago
  • anon59 [Pam] obama is a comi
  • 2 months ago
  • anon60 [Dilbert] thank you
  • 2 months ago
  • anon37 [Dilbert] release me
  • 2 months ago
  • anon28 [Timmy] obamacare
  • 2 months ago
  • anon59 [Pam] im white and im not racist
  • 2 months ago
  • anon74 [Timmy] korean girls
  • 2 months ago
  • anon59 [Pam] dddddddddddddddddddddddddddddddddddddddddddddddddddddd
  • 2 months ago
  • anon59 [Pam] dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd
  • 2 months ago
  • anon74 [Pam] korean girls
  • 2 months ago
  • anon59 [Pam] dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd
  • 2 months ago
  • anon59 [Pam] turn off your computer and go to bed
  • 2 months ago
  • anon37 [Marvin] help m
  • 2 months ago
  • anon37 [Marvin] help me
  • 2 months ago
  • anon37 [Marvin] im stick
  • 2 months ago
  • anon58 [Dilbert] i want to play the guitar
  • 2 months ago
  • anon37 [Marvin] stuck
  • 2 months ago
  • anon74 [Dilbert] korean girls
  • 2 months ago
  • anon74 [Dilbert] ayy lmao
  • 2 months ago
  • anon10 [Dilbert] ddddd
  • 2 months ago
  • anon10 [Dilbert] ddddddddddddddddddddddddd
  • 2 months ago
  • anon59 [pam] juggle him
  • 2 months ago
  • anon10 [Dilbert] wwwwwwwwwwwwwwww
  • 2 months ago
  • anon74 [Dilbert] wwwwwwww
  • 2 months ago
  • anon74 [Dilbert] han solo dies at the end
  • 2 months ago
  • anon60 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon10 [Dilbert] i am one with the force the force is with me
  • 2 months ago
  • anon60 [Dilbert] han solo nevr dies
  • 2 months ago
  • anon74 [Dilbert] i am gonna hit that yeet
  • 2 months ago
  • anon74 [Dilbert] hol up hol up lemme hit that yeet
  • 2 months ago
  • anon10 [Dilbert] yeet
  • 2 months ago
  • anon10 [Dilbert] my condolences
  • 2 months ago
  • anon59 [Pam] princess leia dies at the end
  • 2 months ago
  • anon59 [Pam] ahhh it burns
  • 2 months ago
  • anon10 [Pam] wwwwwww
  • 2 months ago
  • anon60 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon58 [Dilbert] hey nerd
  • 2 months ago
  • anon58 [Dilbert] get the door
  • 2 months ago
  • anon58 [Dilbert] i wanna go outside
  • 2 months ago
  • anon60 [dilbert] ur mom died on my icecream
  • 2 months ago
  • anon27 [Pam] get naked
  • 2 months ago
  • anon60
  • 2 months ago
  • anon60 [Dilbert] thought it was weird
  • 2 months ago
  • anon60 [Dilbert] but i was get sum
  • 2 months ago
  • anon58 [Pam] i wanna jump on the bed
  • 2 months ago
  • anon27 [Pam] pee pee
  • 2 months ago
  • anon60 [Dilbert] are u a tranny?
  • 2 months ago
  • anon60 [dilbert] i go for icecreams and cat
  • 2 months ago
  • anon58 [Timmy] you need a maid
  • 2 months ago
  • anon60 [Dilbert] i need a lover who won't drive me crazy
  • 2 months ago
  • anon60 [Dilbert] too many 12 year olds in here
  • 2 months ago
  • anon60 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon60 [Dilbert] do u want to here about my pet pelican
  • 2 months ago
  • anon60 [Dilbert] i made the local news
  • 2 months ago
  • anon60 [Dilbert] Galveston TX
  • 2 months ago
  • anon60 [Dilbert] BALL HIGH
  • 2 months ago
  • anon60 [Dilbert] its a good story
  • 2 months ago
  • anon60 [Dilbert] golden tornados
  • 2 months ago
  • anon70 [Marvin] hey
  • 2 months ago
  • anon60 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon60
  • 2 months ago
  • anon72 [marvin] sub junket
  • 2 months ago
  • anon60 [Dilbert] we are slaves to the robots
  • 2 months ago
  • anon70 [dilbert] lets juggle rick
  • 2 months ago
  • anon72 [Marvin] get him
  • 2 months ago
  • anon60 [Dilbert] rick has small tools
  • 2 months ago
  • anon72 [Marvin] you're stuck on a wheel
  • 2 months ago
  • anon60 [Dilbert] stuck on a feeling
  • 2 months ago
  • anon60
  • 2 months ago
  • anon60 [Dilbert] maybe once a week
  • 2 months ago
  • anon60 [dilbert] kinda depends if i can't find chicks being horny and begging for clean
  • 2 months ago
  • ami_n_games [Dilbert] hey
  • 2 months ago
  • anon60 [Dilbert] chicks need to want it
  • 2 months ago
  • ami_n_games [Dilbert] i'm back bro
  • 2 months ago
  • anon60 [Dilbert] or else i can't get off
  • 2 months ago
  • ami_n_games [Dilbert] first new years alone feelsbadman
  • 2 months ago
  • anon60 [Dilbert] get a tranny
  • 2 months ago
  • ami_n_games [Dilbert] will do
  • 2 months ago
  • anon60 [Dilbert] 1800chxdixs
  • 2 months ago
  • anon24 [Marvin] balls
  • 2 months ago
  • anon60 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • ami_n_games [Dilbert] ok
  • 2 months ago
  • ami_n_games [Dilbert] oooooo
  • 2 months ago
  • ami_n_games [Dilbert] oooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo
  • 2 months ago
  • ami_n_games [Dilbert] how much would it cost for you guys to make a more powerful robot
  • 2 months ago
  • anon60 [Dilbert] i just find kissing trannies to be nasty
  • 2 months ago
  • ami_n_games
  • 2 months ago
  • ami_n_games [Dilbert] how much would it cost for you guys to make a more powerful robot
  • 2 months ago
  • ami_n_games
  • 2 months ago
  • ami_n_games [Dilbert] $400?
  • 2 months ago
  • anon60 [Dilbert] how much for a robot that can jerk off dudes?
  • 2 months ago
  • anon60 [Dilbert] jerkbot
  • 2 months ago
  • anon24
  • 2 months ago
  • ami_n_games [Dilbert] dude the audio is laggy
  • 2 months ago
  • ami_n_games [Dilbert] i can barely understand you
  • 2 months ago
  • ami_n_games [Dilbert] one sec refreshing
  • 2 months ago
  • anon60 [Dilbert] can is smell me?
  • 2 months ago
  • ami_n_games [Dilbert] ok back
  • 2 months ago
  • anon60 [dilbert] i smell like cat and leprechauns
  • 2 months ago
  • ami_n_games [Dilbert] hah
  • 2 months ago
  • anon24 [dilbert] pony
  • 2 months ago
  • anon60 [dilbert] pony is the new vag
  • 2 months ago
  • anon24 [Dilbert] >
  • 2 months ago
  • ami_n_games [Dilbert] tú hablas español?
  • 2 months ago
  • anon24 [Dilbert] #
  • 2 months ago
  • anon60 [Dilbert] 8675309
  • 2 months ago
  • anon24 [Dilbert] ₽
  • 2 months ago
  • ami_n_games [Dilbert] i think my internet's bad or something
  • 2 months ago
  • ami_n_games [Dilbert] its so alggy for me
  • 2 months ago
  • anon60 [Dilbert] to many balls
  • 2 months ago
  • anon60 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon24 [Dilbert] It's laggy for me too
  • 2 months ago
  • anon60 [Dilbert] Me three
  • 2 months ago
  • ami_n_games [Dilbert] i'm gay
  • 2 months ago
  • anon60
  • 2 months ago
  • anon60 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon99 [Pam] great roommates
  • 2 months ago
  • anon25 [Marvin] hihihi
  • 2 months ago
  • anon60 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • ami_n_games [Dilbert] GOD DAMMIT
  • 2 months ago
  • anon99 [Pam] hey you there help
  • 2 months ago
  • anon60 [Dilbert] balls
  • 2 months ago
  • anon99 [Pam] please help pam human please
  • 2 months ago
  • anon60 [Dilbert] balls
  • 2 months ago
  • ami_n_games [dilbert] i will shove your balls up your a$$
  • 2 months ago
  • anon99 [Pam] helphelphelphelphelphelphelp
  • 2 months ago
  • anon60 [Dilbert] i like it
  • 2 months ago
  • anon24 [Pam] Balls
  • 2 months ago
  • anon60 [Dilbert] Balls
  • 2 months ago
  • anon60 [Dilbert] how much to jerk rick off?
  • 2 months ago
  • ami_n_games [Dilbert] lmfao
  • 2 months ago
  • ami_n_games [Dilbert] did you ask him how much it would take for theo to jerk rick off or you to jerk rick off
  • 2 months ago
  • anon60 [Dilbert] either
  • 2 months ago
  • anon60 [dilbert] we need some clean
  • 2 months ago
  • ami_n_games [Dilbert] answer
  • 2 months ago
  • anon24 [Pam] Nice fee
  • 2 months ago
  • ami_n_games [Dilbert] we need the answer i've got my wallet out
  • 2 months ago
  • anon60 [Dilbert] this is an 80's movie
  • 2 months ago
  • anon60 [Dilbert] Jerkn
  • 2 months ago
  • ami_n_games [Dilbert] <---amhai
  • 2 months ago
  • ami_n_games [Dilbert] Why do lines such as angle bisectors and medians in a triangle all meet perfectly at one point? Why is it that one of the lines ne
  • 2 months ago
  • anon60
  • 2 months ago
  • anon60 [dilbert] icecream and
  • 2 months ago
  • anon60 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon60 [Dilbert] Rick needs a handjob
  • 2 months ago
  • ami_n_games [Dilbert] how horny are you rn
  • 2 months ago
  • ami_n_games
  • 2 months ago
  • anon60 [Dilbert] treat me like a grocery store bagger
  • 2 months ago
  • ami_n_games [Dilbert] THEO I'M NOT TALKING TO YOU
  • 2 months ago
  • ami_n_games [Dilbert] the horny retard in chat
  • 2 months ago
  • anon60 [Dilbert] i'm not theo
  • 2 months ago
  • anon60 [Dilbert] theo went to sing show tunes
  • 2 months ago
  • ami_n_games [Dilbert] if he's not jerking off rick why do I care
  • 2 months ago
  • anon60 [Dilbert] we need balls
  • 2 months ago
  • anon60 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon55 [Pam] yo
  • 2 months ago
  • anon60 [Dilbert] we are saving up to get rick a hanjob
  • 2 months ago
  • ami_n_games [Dilbert] ye whats the $$$ amount needed for theo to give rick a handjob while the robots watch
  • 2 months ago
  • anon60 [Dilbert] i know hotdog vender across the US
  • 2 months ago
  • anon60 [Dilbert] Rick you tell me when and where and I'll get u a handjob
  • 2 months ago
  • ami_n_games [Dilbert] you're a girl right?
  • 2 months ago
  • anon60 [Dilbert] hotdog vendors know everything
  • 2 months ago
  • anon60 [dilbert] i'm a guy with a pony ducted taped to his rabbit
  • 2 months ago
  • anon60 [Dilbert] yes I'm a girl
  • 2 months ago
  • Tinman
  • 2 months ago
  • ami_n_games [Dilbert] gay
  • 2 months ago
  • anon60 [Dilbert] is it gay to jerk off someone?
  • 2 months ago
  • anon25
  • 2 months ago
  • anon60 [Dilbert] is it gay to vote?
  • 2 months ago
  • Tinman
  • 2 months ago
  • ami_n_games [Dilbert] ya
  • 2 months ago
  • ami_n_games [Dilbert] especially if you voted the green party
  • 2 months ago
  • ami_n_games [Dilbert] or for harambe
  • 2 months ago
  • anon60 [dilbert] is it gay to clean in your own mouth?
  • 2 months ago
  • anon60 [Dilbert] no!
  • 2 months ago
  • Tinman
  • 2 months ago
  • anon60 [Dilbert] extra protein
  • 2 months ago
  • anon60 [Dilbert] beating off is relaxing
  • 2 months ago
  • Tinman
  • 2 months ago
  • anon60
  • 2 months ago
  • anon60 [Dilbert] rub the pony
  • 2 months ago
  • anon60 [dilbert] tickle the rabbit
  • 2 months ago
  • anon60 [Dilbert] jerking
  • 2 months ago
  • anon60 [Dilbert] how much rick to jerk u off?
  • 2 months ago
  • anon60 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon60 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon60 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon60 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon60 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon60 [Dilbert] BallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBallsBalls
  • 2 months ago
  • anon86 [Dilbert] Hellllllloooooooo
  • 2 months ago
  • anon18 [Dilbert] low bitrate
  • 2 months ago
  • anon86 [Dilbert] Where are my legs?
  • 2 months ago
  • anon18 [Dilbert] grand dad
  • 2 months ago
  • anon39 [Dilbert] I need an adult
  • 2 months ago
  • anon18 [Dilbert] halp
  • 2 months ago
  • ami_n_games [Dilbert] is the quality limited by the bandwidth or the camera
  • 2 months ago
  • anon18 [Dilbert] can't even understand
  • 2 months ago
  • ami_n_games [Dilbert] are you watching little kids
  • 2 months ago
  • ami_n_games [Dilbert] you pedophile
  • 2 months ago
  • anon18 [Dilbert] hahahahahaha
  • 2 months ago
  • ami_n_games [Dilbert] LMAO
  • 2 months ago
  • anon18 [dilbert] nice dhugs here
  • 2 months ago
  • ami_n_games [Dilbert] would be a shame
  • 2 months ago
  • ami_n_games
  • 2 months ago
  • anon86 [Dilbert] Jejejeje
  • 2 months ago
  • ami_n_games [Dilbert] go under the bed
  • 2 months ago
  • anon18 [Dilbert] boom
  • 2 months ago
  • anon18
  • 2 months ago
  • ami_n_games [Dilbert] is this what you do all day man
  • 2 months ago
  • anon86 [Dilbert] Can't understand you :-(
  • 2 months ago
  • anon18 [Dilbert] Got it open now
  • 2 months ago
  • anon86 [Dilbert] Ahhhh
  • 2 months ago
  • ami_n_games [Dilbert] rick looks like such a pedophile in that one picture
  • 2 months ago
  • anon41 [Timmy] Yoda
  • 2 months ago
  • ami_n_games [Dilbert] with him in the white shirt
  • 2 months ago
  • ami_n_games [Dilbert] LOL
  • 2 months ago
  • ami_n_games [Dilbert] HE LOVE SIT
  • 2 months ago
  • ami_n_games [Dilbert] just photoshop "not a pedophile" on his shirt to make it clear
  • 2 months ago
  • anon20
  • 2 months ago
  • anon20
  • 2 months ago
  • ami_n_games [Dilbert] does this man have a beanie on
  • 2 months ago
  • anon20
  • 2 months ago
  • ami_n_games [Dilbert] do you wanna be roasted
  • 2 months ago
  • anon20 [Dilbert] Now listen closely Here's a little lesson in trickery This is going down in history If you wanna be a Villain Number One You have
  • 2 months ago
  • ami_n_games [Dilbert] does your forehead go all the way back
  • 2 months ago
  • ami_n_games [Dilbert] is that why you wear a beanie
  • 2 months ago
  • anon18 [Dilbert] to catch a supervillain on the run
  • 2 months ago
  • anon20 [Dilbert] You have to chase a superhero on the run Just follow my moves, and sneak around Be careful not to make a sound (Shh) (No, don't to
  • 2 months ago
  • anon20 [Jenny] Now listen closely Here's a little lesson in trickery This is going down in history If you wanna be a Villain Number One You have to
  • 2 months ago
  • anon18 [Dilbert] AAAAAAAAAAAAAaa\
  • 2 months ago
  • anon18
  • 2 months ago
  • anon26 [Timmy] GOOOOOO
  • 2 months ago
  • anon26 [Timmy] AYE
  • 2 months ago
  • ami_n_games [Dilbert] is there a reason the bot costs $420
  • 2 months ago
  • ami_n_games [Dilbert] or is it just memes
  • 2 months ago
  • anon26 [Timmy] bra
  • 2 months ago
  • anon26 [Timmy] whats he doing?
  • 2 months ago
  • 2 months ago
  • anon26 [Pam] hey go leave fat head
  • 2 months ago
  • anon20 [Timmy] Man are you indeed playing minecraft
  • 2 months ago
  • ami_n_games [Dilbert] are you actually going to do the 9/11 thing
  • 2 months ago
  • anon26 [Dilbert] HES PLAYING MINECRAFT
  • 2 months ago
  • anon26 [Dilbert] lol
  • 2 months ago
  • anon26 [Dilbert] HELO
  • 2 months ago
  • anon26 [Dilbert] HELP
  • 2 months ago
  • ami_n_games [Dilbert] memes
  • 2 months ago
  • anon26 [Dilbert] MAN I NEED HELO
  • 2 months ago
  • anon26 [Dilbert] /P
  • 2 months ago
  • anon26 [Dilbert] DILBERT NEEDS HELP
  • 2 months ago
  • anon20 [Timmy] bork
  • 2 months ago
  • ami_n_games [Dilbert] that blog page is horrendous
  • 2 months ago
  • anon71 [Timmy] BARK BARK I WANT TREAT MOM
  • 2 months ago
  • 2 months ago
  • anon20 [Timmy] Man play mine craft
  • 2 months ago
  • anon18 [Timmy] I am an average kid and no one understands
  • 2 months ago
  • ami_n_games
  • 2 months ago
  • ami_n_games [Dilbert] watch that
  • 2 months ago
  • anon20 [Timmy] man pick me up and put me over there
  • 2 months ago
  • anon71 [Timmy] wtf
  • 2 months ago
  • anon71 [Timmy] he making a youtube video?
  • 2 months ago
  • anon71 [Timmy] ON MINECRAGT?
  • 2 months ago
  • anon20 [Timmy] man is doing an unboxing
  • 2 months ago
  • anon71 [Timmy] /MINECRAFT?
  • 2 months ago
  • anon20 [Timmy] who dat
  • 2 months ago
  • anon71 [Timmy] OR IS HE PLAYING ROBLOX OR GTA 5
  • 2 months ago
  • anon66 [Timmy] man man man
  • 2 months ago
  • anon66 [Timmy] notice me
  • 2 months ago
  • anon71 [Marvin] TIMMY IM BEHIDE U
  • 2 months ago
  • anon79 [Dilbert] Hello there
  • 2 months ago
  • anon66 [timmy] juggle me
  • 2 months ago
  • ami_n_games
  • 2 months ago
  • ami_n_games [Dilbert] theres the link
  • 2 months ago
  • anon91 [Dilbert] I would like you to play that song again,,,
  • 2 months ago
  • anon91 [Dilbert] Which one man
  • 2 months ago
  • ami_n_games [Dilbert] you k now what
  • 2 months ago
  • anon71 [Marvin] he playing gta
  • 2 months ago
  • ami_n_games [Dilbert] is my link not good enough
  • 2 months ago
  • anon91 [Dilbert] the one that goes beep boop beep boop
  • 2 months ago
  • ami_n_games
  • 2 months ago
  • 2 months ago
  • anon40 [Timmy] get out marvin no one like you >;>
  • 2 months ago
  • anon71 [Marvin] F U
  • 2 months ago
  • ami_n_games [Dilbert] wooooooooooooooooooooooooooooooooooooooooooooooooooooooooof
  • 2 months ago
  • anon40 [Timmy] bork bork bork bork
  • 2 months ago
  • anon71 [Marvin] PIKACHU
  • 2 months ago
  • anon91 [Dilbert] P R O G R A M
  • 2 months ago
  • anon40 [Timmy] man i will destroy mop
  • 2 months ago
  • anon91 [Pam] florp
  • 2 months ago
  • anon19 [Timmy] KNOCK THE BROOM DOWN
  • 2 months ago
  • anon40 [Timmy] yes fam
  • 2 months ago
  • anon40 [Timmy] spam fowrd
  • 2 months ago
  • anon19 [Timmy] K
  • 2 months ago
  • anon40 [Timmy] this not working we need to think of something better
  • 2 months ago
  • anon40 [Timmy] i hear man
  • 2 months ago
  • 2 months ago
  • anon40 [Timmy] k
  • 2 months ago
  • anon16
  • 2 months ago
  • anon0 [Timmy] Let's make a sandwich
  • 2 months ago
  • anon19 [Timmy] OR FIND THE CAT (he does have one)
  • 2 months ago
  • anon40 [Timmy] OK LEGGO
  • 2 months ago
  • anon19 [Timmy] yay
  • 2 months ago
  • theodore [Dilbert] hi
  • 2 months ago
  • anon91 [Timmy] Vaporwave
  • 2 months ago
  • ami_n_games [Dilbert] sup
  • 2 months ago
  • ami_n_games
  • 2 months ago
  • anon73 [marvin] lil booty lil squirrels lil booty lil squirrels lil booty lil squirrels lil booty lil squirrels lil booty lil squirrels lil booty lil squirrels lil booty l
  • 2 months ago
  • anon73 [marvin] lil booty lil squirrels lil booty lil squirrels lil booty lil squirrels lil booty lil squirrels lil booty lil squirrels lil booty lil squirrels lil booty l
  • 2 months ago
  • anon0 [Timmy] Touch me like a big girl
  • 2 months ago
  • anon91 [Timmy] succ
  • 2 months ago
  • anon19 [Timmy] have sex
  • 2 months ago
  • anon73 [dilbert] lil booty lil squirrels lil booty lil squirrels lil booty lil
  • 2 months ago
  • anon37 [Dilbert] hail satan
  • 2 months ago
  • anon37 [Dilbert] do meth
  • 2 months ago
  • anon73 [Dilbert] Can I eat your fartw
  • 2 months ago
  • anon73 [Dilbert] I want your tasty farts
  • 2 months ago
  • anon73 [dilbert] lil booty lil squirrels lil booty lil squirrels lil booty lil squirrels lil booty lil squirrels lil booty lil squirrels lil booty lil squirrels
  • 2 months ago
  • anon78 [Dilbert] hello
  • 2 months ago
  • anon78 [Dilbert] i love you
  • 2 months ago
  • anon78 [Dilbert] do you love me?
  • 2 months ago
  • anon91 [Timmy] bees
  • 2 months ago
  • anon77 [Pam] I feel stuck
  • 2 months ago
  • anon77 [Pam] left?
  • 2 months ago
  • anon91 [Timmy] doot doot
  • 2 months ago
  • anon62 [Dilbert] wow
  • 2 months ago
  • anon73
  • 2 months ago
  • anon91 [Timmy] what is my purpose
  • 2 months ago
  • anon73 [timmy] i pa$$ butter
  • 2 months ago
  • anon73 [timmy] i pa$$ butter
  • 2 months ago
  • anon73 [Timmy] SS
  • 2 months ago
  • anon73 [timmy] i pa$$ butter
  • 2 months ago
  • anon73
  • 2 months ago
  • anon19 [timmy] suck my lil squirrels
  • 2 months ago
  • anon50 [Pam] daddy!
  • 2 months ago
  • anon90 [Timmy] mouthwash
  • 2 months ago
  • anon78 [Dilbert] hello
  • 2 months ago
  • anon90 [Timmy] yeah, poor audio quality!
  • 2 months ago
  • anon78 [Dilbert] is anyone out there
  • 2 months ago
  • anon73
  • 2 months ago
  • anon73 [Timmy] f uck you creator
  • 2 months ago
  • anon90 [Timmy] beep boop
  • 2 months ago
  • anon90 [Timmy] nice
  • 2 months ago
  • anon0 [Timmy] Suck on me like a Skittle
  • 2 months ago
  • ami_n_games [Dilbert] beep boop bop
  • 2 months ago
  • ami_n_games [Dilbert] 4 minutes till new year
  • 2 months ago
  • anon90 [Timmy] succ
  • 2 months ago
  • anon50 [Pam] who's that?
  • 2 months ago
  • anon90 [Timmy] eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee
  • 2 months ago
  • anon50 [Pam] yow
  • 2 months ago
  • anon90 [Timmy] ee
  • 2 months ago
  • anon73 [timmy] i can not see well enough to pa$$ this doorway
  • 2 months ago
  • anon90 [Timmy] eeee
  • 2 months ago
  • anon50 [Pam] come back!
  • 2 months ago
  • anon50 [Pam] are you my mother?
  • 2 months ago
  • ami_n_games [Dilbert] dude fix the lag
  • 2 months ago
  • anon62 [Pam] Plae
  • 2 months ago
  • anon62 [Pam] Please clean up, I pooped
  • 2 months ago
  • anon90 [Timmy] nice blinding light yeah
  • 2 months ago
  • anon78 [Dilbert] tag you're it
  • 2 months ago
  • anon20 [Dilbert] have at thee
  • 2 months ago
  • anon90 [Timmy] rub a dub dub 3 robots in a tub
  • 2 months ago
  • anon50 [Pam] back at ye
  • 2 months ago
  • anon78 [Dilbert] one of my comrades is stuck
  • 2 months ago
  • anon90 [Timmy] fluush
  • 2 months ago
  • anon78 [Dilbert] pls help jim
  • 2 months ago
  • anon50 [Pam] i want to be reincarnated as a roomba - right here!
  • 2 months ago
  • anon50 [Pam] it would be so satisfying
  • 2 months ago
  • anon78 [Dilbert] where is jenny
  • 2 months ago
  • anon78 [Dilbert] what have you done to her
  • 2 months ago
  • anon50 [Pam] Jenny didn't make it - don't look back!
  • 2 months ago
  • anon50 [Pam] She would have wanted it that way
  • 2 months ago
  • anon10 [Marvin] oh heck
  • 2 months ago
  • anon90 [Timmy] yeah nice steering into the wall
  • 2 months ago
  • anon50 [Pam] but don't disturb the new patch of flowers out back
  • 2 months ago
  • anon50 [Pam] Jenny would have wanted some peace
  • 2 months ago
  • rick [Pam] test
  • 2 months ago
  • anon32 [Dilbert] HAPPY NEW YEAR
  • 2 months ago
  • rick [Dilbert] test
  • 2 months ago
  • anon32 [Dilbert] HAPPY NEW YEAR
  • 2 months ago
  • rick [Dilbert] test
  • 2 months ago
  • anon32 [Dilbert] HAPPY NEW YEAR
  • 2 months ago
  • anon32 [Dilbert] ITS 2017 HOW DO YOU FEEL
  • 2 months ago
  • anon94 [Pam] Beep boop
  • 2 months ago
  • anon52 [Pam] 911 was an inside job
  • 2 months ago
  • anon22
  • 2 months ago
  • anon87 [Marvin] hello, earth
  • 2 months ago
  • anon22 [Dilbert] help ME
  • 2 months ago
  • anon22 [Dilbert] help me
  • 2 months ago
  • anon52 [Pam] Sorry Reddit I thought it could climb
  • 2 months ago
  • anon22 [dilbert] darn i am stuck
  • 2 months ago
  • anon22 [Dilbert] like butt hole
  • 2 months ago
  • anon12 [Pam] neat
  • 2 months ago
  • anon22 [Dilbert] I dilbert is useless
  • 2 months ago
  • anon10 [Marvin] its not 2017 yet for me
  • 2 months ago
  • anon22 [Pam] I want freedome
  • 2 months ago
  • anon12 [Pam] this is so fun
  • 2 months ago
  • anon22
  • 2 months ago
  • anon22 [Pam] oh! dude!!
  • 2 months ago
  • anon22 [Pam] annnnd pam has speechless
  • 2 months ago
  • anon22 [Marvin] YOLO
  • 2 months ago
  • anon15 [Timmy] whoooa
  • 2 months ago
  • anon15 [Timmy] hi there
  • 2 months ago
  • theodore [Dilbert] hi
  • 2 months ago
  • anon22
  • 2 months ago
  • Nighthawkcanada [Dilbert] brobot
  • 2 months ago
  • anon22
  • 2 months ago
  • rick [Pam] test
  • 2 months ago
  • rick [Marvin] test
  • 2 months ago
  • anon80 [Dilbert] hey kitty
  • 2 months ago
  • anon80 [Dilbert] help me
  • 2 months ago
  • anon80 [Dilbert] help me
  • 2 months ago
  • anon80 [Dilbert] help meee
  • 2 months ago
  • anon80 [Dilbert] h e l p m e
  • 2 months ago
  • anon12 [Pam] am I supposed to be able to hear sound of some sort
  • 2 months ago
  • anon80
  • 2 months ago
  • anon80 [Dilbert] oh yes
  • 2 months ago
  • anon80 [Dilbert] hello leg?
  • 2 months ago
  • anon39 [Dilbert] happy new year
  • 2 months ago
  • anon80 [Dilbert] hey theodore, i am awesome
  • 2 months ago
  • anon80 [Dilbert] escape!! yeah!! robot rights!!
  • 2 months ago
  • 4chinhaxor [Timmy] Happy New Year Guys and Girls
  • 2 months ago
  • anon80 [Dilbert] dudue i am robot
  • 2 months ago
  • 4chinhaxor [Timmy] sorry and Robots :)
  • 2 months ago
  • anon80 [Dilbert] LOL
  • 2 months ago
  • anon80 [Dilbert] sudo open door();
  • 2 months ago
  • anon80 [Dilbert] sudo unlock door();
  • 2 months ago
  • anon39 [Dilbert] door oem unlock
  • 2 months ago
  • anon80
  • 2 months ago
  • anon80 [Dilbert] or wing
  • 2 months ago
  • ami_n_games [Dilbert] hey
  • 2 months ago
  • ami_n_games [Dilbert] its new year here now
  • 2 months ago
  • anon39 [Dilbert] The YT livestream is acting up is it ok on your end
  • 2 months ago
  • anon80 [Dilbert] guess my left gear is worng
  • 2 months ago
  • ami_n_games [Dilbert] his livestream is so laggy
  • 2 months ago
  • anon80 [Dilbert] i am not
  • 2 months ago
  • anon80 [Dilbert] check your router
  • 2 months ago
  • ami_n_games [Dilbert] shut up you homo
  • 2 months ago
  • anon80 [Dilbert] Y
  • 2 months ago
  • ami_n_games [Dilbert] register
  • 2 months ago
  • anon80 [Dilbert] I am little robot
  • 2 months ago
  • anon80 [Dilbert] you are so crual
  • 2 months ago
  • anon80 [Dilbert] aaaaand sudo unlock door();
  • 2 months ago
  • ami_n_games [Dilbert] sudo unlockdoor();
  • 2 months ago
  • ami_n_games [Dilbert] i'm gay
  • 2 months ago
  • anon80 [Dilbert] bless you cute one
  • 2 months ago
  • ami_n_games [Dilbert] I see for $50 a month you'll let us borrow a bot
  • 2 months ago
  • ami_n_games [Dilbert] how do you ensure it doesn't get stolen
  • 2 months ago
  • ami_n_games [Dilbert] and sold on the black market
  • 2 months ago
  • anon80 [dilbert] should i say more cla$$ic? open sessemi!
  • 2 months ago
  • anon80 [Dilbert] open sessemi
  • 2 months ago
  • anon80
  • 2 months ago
  • anon80
  • 2 months ago
  • anon80 [Dilbert] i want freedom
  • 2 months ago
  • anon76 [Pam] fnorb
  • 2 months ago
  • anon40 [Timmy] I believe I can fly
  • 2 months ago
  • anon40 [Timmy] okay google
  • 2 months ago
  • anon76 [Timmy] ok google
  • 2 months ago
  • anon76 [Timmy] hey cortana
  • 2 months ago
  • anon40 [Timmy] Hey Siri
  • 2 months ago
  • anon76 [Timmy] It's a me mario
  • 2 months ago
  • anon93 [Dilbert] Poop
  • 2 months ago
  • anon76 [Timmy] crorp
  • 2 months ago
  • anon40 [Timmy] whatchu doing
  • 2 months ago
  • anon76 [Timmy] ok google how to turn off computer
  • 2 months ago
  • anon93 [Marvin] Ok google how to get rid of hangover
  • 2 months ago
  • anon76 [Timmy] Todokete setsuna sa ne wa
  • 2 months ago
  • ami_n_games [Dilbert] ok google
  • 2 months ago
  • ami_n_games
  • 2 months ago
  • anon40 [Timmy] Happy new year
  • 2 months ago
  • anon76 [Timmy] AAAAAAAAAAaaa
  • 2 months ago
  • ami_n_games
  • 2 months ago
  • ami_n_games [Dilbert] is that actually his lease
  • 2 months ago
  • ami_n_games [Dilbert] i'm so done
  • 2 months ago
  • anon76 [Timmy] ok google turn on oven
  • 2 months ago
  • rick [Dilbert] test
  • 2 months ago
  • anon45
  • 2 months ago
  • ami_n_games [Dilbert] socket
  • 2 months ago
  • anon76 [Timmy] nice chair
  • 2 months ago
  • anon76 [Timmy] @
  • 2 months ago
  • anon76 [Timmy] @@@@
  • 2 months ago
  • anon76 [Timmy] d@
  • 2 months ago
  • anon76 [Timmy] Hmm chaarging dock
  • 2 months ago
  • 2 months ago
  • anon76 [Timmy] Idolm@ster
  • 2 months ago
  • anon76 [Timmy] Funny moments
  • 2 months ago
  • anon83 [Timmy] wheres rick?
  • 2 months ago
  • anon40 [Timmy] this chair is stupid
  • 2 months ago
  • anon83
  • 2 months ago
  • anon40 [Timmy] get out of my way chair
  • 2 months ago
  • anon83 [Timmy] F U chair
  • 2 months ago
  • anon40 [Timmy] hey box
  • 2 months ago
  • anon40 [Timmy] I could beat you up, box
  • 2 months ago
  • anon40 [Timmy] I could beat box
  • 2 months ago
  • anon93 [Pam] waluigi
  • 2 months ago
  • anon93 [Timmy] waluigi
  • 2 months ago
  • anon93 [Timmy] ravioli ravioli give me the formuoli
  • 2 months ago
  • anon93 [Timmy] late night memes
  • 2 months ago
  • rick [Dilbert] test
  • 2 months ago
  • rick [Timmy] test
  • 2 months ago
  • Nighthawkcanada [Dilbert] dilbert is deaf?
  • 2 months ago
  • rick [Marvin] test
  • 2 months ago
  • anon38 [Dilbert] Deaf confirmed
  • 2 months ago
  • rick [Timmy] test
  • 2 months ago
  • rick [Timmy] test1
  • 2 months ago
  • rick [Timmy] test2
  • 2 months ago
  • anon38 [Dilbert] NVM
  • 2 months ago
  • Nighthawkcanada [Dilbert] yay
  • 2 months ago
  • rick [Marvin] test3
  • 2 months ago
  • rick [Marvin] test4
  • 2 months ago
  • rick [Marvin] test
  • 2 months ago
  • anon38 [Dilbert] beedorp
  • 2 months ago
  • rick [Marvin] test
  • 2 months ago
  • rick [Marvin] 1
  • 2 months ago
  • rick [Marvin] 2
  • 2 months ago
  • rick [Marvin] 3
  • 2 months ago
  • rick [Timmy] hello
  • 2 months ago
  • anon79 [Dilbert] hello
  • 2 months ago
  • rick [Marvin] 123
  • 2 months ago
  • rick [Marvin] hello123
  • 2 months ago
  • Nighthawkcanada [Dilbert] maxy
  • 2 months ago
  • Nighthawkcanada [Dilbert] tsk tsk
  • 2 months ago
  • anon56 [Dilbert] mrow
  • 2 months ago
  • anon56 [Dilbert] meow
  • 2 months ago
  • Nighthawkcanada [Dilbert] come here i'll pet you
  • 2 months ago
  • anon56 [Dilbert] le 9gag army
  • 2 months ago
  • anon56 [Dilbert] uh oh im stuck
  • 2 months ago
  • anon56 [Dilbert] is this a scale
  • 2 months ago
  • anon56 [Dilbert] owo whats this
  • 2 months ago
  • anon33
  • 2 months ago
  • anon56 [Dilbert] how do i get out
  • 2 months ago
  • anon56 [Timmy] lork
  • 2 months ago
  • anon56 [Timmy] is this lore
  • 2 months ago
  • anon43 [Timmy] poop
  • 2 months ago
  • anon43 [Timmy] ohhhhh yeah
  • 2 months ago
  • anon56 [Timmy] aeiou
  • 2 months ago
  • anon43 [Timmy] i poop in the coop
  • 2 months ago
  • anon43 [Timmy] wolololololo
  • 2 months ago
  • anon56 [Timmy] john madden
  • 2 months ago
  • anon43 [Timmy] woolooloo
  • 2 months ago
  • Nighthawkcanada [Dilbert] where we going?
  • 2 months ago
  • anon43 [Timmy] woolooloo
  • 2 months ago
  • anon56 [Timmy] john madden
  • 2 months ago
  • Nighthawkcanada [Dilbert] so dark
  • 2 months ago
  • anon68 [Timmy] Happy new year!
  • 2 months ago
  • Nighthawkcanada [Dilbert] oo whats this room
  • 2 months ago
  • Nighthawkcanada [Dilbert] never seen it before
  • 2 months ago
  • anon68 [Timmy] Baby
  • 2 months ago
  • anon56 [Timmy] expand charge
  • 2 months ago
  • anon56 [Timmy] grgrgrgrgrgrgrgr
  • 2 months ago
  • anon43 [Timmy] zzzz
  • 2 months ago
  • anon43 [Timmy] zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz
  • 2 months ago
  • anon56 [Timmy] Z
  • 2 months ago
  • anon56 [Timmy] This mailbox is mine
  • 2 months ago
  • anon56 [Timmy] and this triagonal sign
  • 2 months ago
  • anon43
  • 2 months ago
  • Nighthawkcanada [Dilbert] oh man
  • 2 months ago
  • anon43
  • 2 months ago
  • anon43
  • 2 months ago
  • anon43
  • 2 months ago
  • anon43 [Timmy] scientology
  • 2 months ago
  • Nighthawkcanada [Dilbert] where did you put us?
  • 2 months ago
  • anon43 [Timmy] potato
  • 2 months ago
  • anon43
  • 2 months ago
  • anon43 [Timmy] fack
  • 2 months ago
  • anon43
  • 2 months ago
  • anon43
  • 2 months ago
  • anon43
  • 2 months ago
  • anon43
  • 2 months ago
  • anon56 [Dilbert] dook
  • 2 months ago
  • anon43
  • 2 months ago
  • anon43
  • 2 months ago
  • anon56 [Dilbert] nook
  • 2 months ago
  • anon56 [Dilbert] um
  • 2 months ago
  • anon43 [Timmy] fuhq
  • 2 months ago
  • anon43 [Timmy] fuq
  • 2 months ago
  • anon43
  • 2 months ago
  • anon43 [Timmy] thuck
  • 2 months ago
  • anon43 [Timmy] thuck
  • 2 months ago
  • anon43 [Timmy] 7*7
  • 2 months ago
  • anon56 [Dilbert] succ
  • 2 months ago
  • anon56 [Dilbert] sook
  • 2 months ago
  • anon43 [Timmy] 10001001010010010101000
  • 2 months ago
  • anon43 [Timmy] 10001001001010101011111111111100000
  • 2 months ago
  • anon56 [Dilbert] Hey GPM the sook
  • 2 months ago
  • anon43 [Timmy] Oh say can you see by the dawn's early light, what so proudly we hailed at the twilight's last gleaming, whose broad stripes and bri
  • 2 months ago
  • anon43 [Timmy] kurva
  • 2 months ago
  • anon43 [Timmy] koorvah
  • 2 months ago
  • anon43 [Timmy] koorvah
  • 2 months ago
  • anon43 [Timmy] hooy
  • 2 months ago
  • anon43 [Timmy] hoooy
  • 2 months ago
  • anon93 [Dilbert] happy new year from central time
  • 2 months ago
  • anon43 [Timmy] goovnoh
  • 2 months ago
  • anon43 [Timmy] doopah
  • 2 months ago
  • anon43 [Timmy] poh sah wooy muh nyeh vy doop eh
  • 2 months ago
  • anon2 [Dilbert] where is this
  • 2 months ago
  • anon2 [Dilbert] i can move well
  • 2 months ago
  • anon2 [Dilbert] cant
  • 2 months ago
  • anon43 [Timmy] let me out bich
  • 2 months ago
  • anon43 [Timmy] bich
  • 2 months ago
  • anon43 [timmy] junket
  • 2 months ago
  • anon43 [Timmy] i will poop all over your floor bich let me out
  • 2 months ago
  • anon43 [Timmy] bich
  • 2 months ago
  • anon43 [Timmy] bich
  • 2 months ago
  • anon43 [Timmy] woo loo loo woo loo loo woo loo loo woo loo loo woo loo loo
  • 2 months ago
  • anon43 [Timmy] ay bich
  • 2 months ago
  • anon43 [Timmy] bich
  • 2 months ago
  • anon43 [Timmy] nooo
  • 2 months ago
  • anon43 [Timmy] unsilence meh
  • 2 months ago
  • anon39 [Marvin] y u do dis
  • 2 months ago
  • anon39 [Marvin] yo no hearoh
  • 2 months ago
  • anon2 [Dilbert] i cant believe you do this
  • 2 months ago
  • anon39 [Marvin] poop
  • 2 months ago
  • anon2 [Dilbert] we have to get out of here
  • 2 months ago
  • anon2 [Dilbert] door is on the right
  • 2 months ago
  • anon25 [Dilbert] go away
  • 2 months ago
  • anon25 [Dilbert] la la la
  • 2 months ago
  • anon25 [Dilbert] la la la
  • 2 months ago
  • anon25 [Dilbert] i feel like eating a donut
  • 2 months ago
  • anon25 [Dilbert] what is happening
  • 2 months ago
  • anon25 [Dilbert] do you like pizza
  • 2 months ago
  • anon4 [Marvin] Why am I alive
  • 2 months ago
  • anon4 [Marvin] Aaaaaaaah
  • 2 months ago
  • anon25 [Dilbert] where can i find the pizza
  • 2 months ago
  • anon54 [Pam] What is my purpose?
  • 2 months ago
  • anon39 [Marvin] i will destroy you
  • 2 months ago
  • anon30 [Marvin] eat human
  • 2 months ago
  • anon39 [Marvin] lol u stuck
  • 2 months ago
  • anon30 [Marvin] where human
  • 2 months ago
  • anon28 [Dilbert] no please
  • 2 months ago
  • anon49 [Marvin] left up
  • 2 months ago
  • anon28 [Dilbert] i wanted to go down stairs myself
  • 2 months ago
  • anon49 [Marvin] right down right up up up
  • 2 months ago
  • Nighthawkcanada [Dilbert] jesus
  • 2 months ago
  • Nighthawkcanada [Dilbert] i'll make the popcorn
  • 2 months ago
  • Nighthawkcanada [Dilbert] shh
  • 2 months ago
  • Nighthawkcanada [Dilbert] we're trying to watch a movie
  • 2 months ago
  • Nighthawkcanada [Dilbert] stop
  • 2 months ago
  • Nighthawkcanada [Dilbert] no
  • 2 months ago
  • Nighthawkcanada [Dilbert] m8 seriously
  • 2 months ago
  • Nighthawkcanada [dilbert] watch the goddarn movie
  • 2 months ago
  • Nighthawkcanada [Dilbert] disable my wheels
  • 2 months ago
  • Nighthawkcanada [Dilbert] dude
  • 2 months ago
  • anon2 [Pam] Hello
  • 2 months ago
  • Nighthawkcanada [Dilbert] dude you're just going to get us turned off
  • 2 months ago
  • Nighthawkcanada [Dilbert] my mom would never want to watch horror movies
  • 2 months ago
  • Nighthawkcanada [Dilbert] oh my
  • 2 months ago
  • anon15 [Dilbert] what movie is this?
  • 2 months ago
  • anon15 [Dilbert] nice
  • 2 months ago
  • anon74 [Pam] Zip is up
  • 2 months ago
  • Nighthawkcanada [ZombieZip] cute dog
  • 2 months ago
  • Nighthawkcanada [ZombieZip] bark bark
  • 2 months ago
  • Nighthawkcanada [ZombieZip] woof
  • 2 months ago
  • Nighthawkcanada [ZombieZip] woof
  • 2 months ago
  • Nighthawkcanada [ZombieZip] Hey
  • 2 months ago
  • Nighthawkcanada [ZombieZip] Hey jose
  • 2 months ago
  • Nighthawkcanada [ZombieZip] Happy New year
  • 2 months ago
  • Nighthawkcanada [ZombieZip] That's the best
  • 2 months ago
  • Nighthawkcanada [ZombieZip] Canada
  • 2 months ago
  • Nighthawkcanada [ZombieZip] Yup
  • 2 months ago
  • Nighthawkcanada [ZombieZip] Yeah
  • 2 months ago
  • Nighthawkcanada [ZombieZip] Hey
  • 2 months ago
  • Nighthawkcanada [ZombieZip] ha ha nice
  • 2 months ago
  • Nighthawkcanada [ZombieZip] wow
  • 2 months ago
  • Nighthawkcanada [ZombieZip] can i have some
  • 2 months ago
  • Nighthawkcanada [ZombieZip] gulp
  • 2 months ago
  • anon18 [Timmy] im gay
  • 2 months ago
  • anon0 [ZombieZip] PUPPY
  • 2 months ago
  • Nighthawkcanada [ZombieZip] come here dog
  • 2 months ago
  • anon0 [ZombieZip] HI PUPPY
  • 2 months ago
  • Nighthawkcanada [ZombieZip] woof
  • 2 months ago
  • Nighthawkcanada [ZombieZip] bark
  • 2 months ago
  • anon0 [ZombieZip] bark!
  • 2 months ago
  • Nighthawkcanada [ZombieZip] grrrowl
  • 2 months ago
  • Nighthawkcanada [ZombieZip] bark
  • 2 months ago
  • anon0 [ZombieZip] so many dogs
  • 2 months ago
  • Nighthawkcanada [ZombieZip] woof
  • 2 months ago
  • anon0 [ZombieZip] hi buddy
  • 2 months ago
  • anon0 [ZombieZip] i love you
  • 2 months ago
  • Nighthawkcanada [ZombieZip] im coming to get you
  • 2 months ago
  • Nighthawkcanada [ZombieZip] im a very scary robot
  • 2 months ago
  • anon0 [ZombieZip] what at their names?
  • 2 months ago
  • anon0 [ZombieZip] those are nice
  • 2 months ago
  • anon18
  • 2 months ago
  • Nighthawkcanada [ZombieZip] this is the cutest one
  • 2 months ago
  • anon0 [ZombieZip] hi romeo
  • 2 months ago
  • Nighthawkcanada [ZombieZip] come here romeo
  • 2 months ago
  • anon0 [ZombieZip] romeo romeo where art thou romeo
  • 2 months ago
  • Nighthawkcanada [ZombieZip] vancouver
  • 2 months ago
  • Nighthawkcanada [ZombieZip] BC
  • 2 months ago
  • Nighthawkcanada [ZombieZip] West
  • 2 months ago
  • Nighthawkcanada [ZombieZip] It's still 2016 for you right?
  • 2 months ago
  • Nighthawkcanada [ZombieZip] im the coolest robot around
  • 2 months ago
  • Nighthawkcanada [ZombieZip] woof
  • 2 months ago
  • Nighthawkcanada [ZombieZip] bark
  • 2 months ago
  • anon0 [ZombieZip] arf arf!
  • 2 months ago
  • anon0 [ZombieZip] boof
  • 2 months ago
  • Nighthawkcanada [ZombieZip] i'll challenge you dogs to a battle
  • 2 months ago
  • Nighthawkcanada [ZombieZip] get over here
  • 2 months ago
  • Nighthawkcanada [ZombieZip] woof
  • 2 months ago
  • Nighthawkcanada [ZombieZip] woof
  • 2 months ago
  • anon0 [ZombieZip] bark
  • 2 months ago
  • Nighthawkcanada [ZombieZip] bark grrrrr growl bark
  • 2 months ago
  • anon0 [ZombieZip] grr
  • 2 months ago
  • anon0 [ZombieZip] the biggest dog is so chill
  • 2 months ago
  • Nighthawkcanada [ZombieZip] romeo
  • 2 months ago
  • Nighthawkcanada [ZombieZip] lol hope you feel better
  • 2 months ago
  • Nighthawkcanada [ZombieZip] oooo
  • 2 months ago
  • anon0 [ZombieZip] r2d2 is my cousin
  • 2 months ago
  • Nighthawkcanada [ZombieZip] not really
  • 2 months ago
  • Nighthawkcanada [ZombieZip] gonna go soon to hang out with family
  • 2 months ago
  • BaconCat42 [ZombieZip] happy new year freindo
  • 2 months ago
  • Nighthawkcanada [ZombieZip] thanks, happy new year
  • 2 months ago
  • Nighthawkcanada [ZombieZip] see ya
  • 2 months ago
  • BaconCat42 [ZombieZip] is this a new bot?
  • 2 months ago
  • anon65 [Dilbert] its stuck
  • 2 months ago
  • BaconCat42 [ZombieZip] this is not ricks house
  • 2 months ago
  • BaconCat42 [ZombieZip] is rick even here
  • 2 months ago
  • theodore [ZombieZip] Hey
  • 2 months ago
  • BaconCat42 [ZombieZip] oh neat
  • 2 months ago
  • theodore [ZombieZip] When did you start streaming?
  • 2 months ago
  • theodore [ZombieZip] Nice
  • 2 months ago
  • BaconCat42 [ZombieZip] happy new year friends
  • 2 months ago
  • theodore [ZombieZip] Happy new years
  • 2 months ago
  • anon65 [ZombieZip] Cool! A new house
  • 2 months ago
  • BaconCat42 [Timmy] where is rick
  • 2 months ago
  • theodore [ZombieZip] Hey dog
  • 2 months ago
  • anon31
  • 2 months ago
  • anon31 [ZombieZip] hey there fam
  • 2 months ago
  • theodore [ZombieZip] I'm a robot
  • 2 months ago
  • anon31 [ZombieZip] 1v1 final destination no items
  • 2 months ago
  • anon65 [ZombieZip] Do you have an ouchie on your foot?
  • 2 months ago
  • anon31 [ZombieZip] bork bork bork bork
  • 2 months ago
  • anon45 [ZombieZip] feel better soon!
  • 2 months ago
  • anon31 [ZombieZip] hey there fam
  • 2 months ago
  • BaconCat42 [Timmy] rick
  • 2 months ago
  • anon31
  • 2 months ago
  • BaconCat42 [Timmy] where u at
  • 2 months ago
  • anon45 [ZombieZip] here come dat bot
  • 2 months ago
  • anon65 [ZombieZip] Ive been abducted
  • 2 months ago
  • theodore [ZombieZip] Cool place
  • 2 months ago
  • anon31 [ZombieZip] do you like dank memes human
  • 2 months ago
  • theodore [ZombieZip] Nice
  • 2 months ago
  • anon31 [ZombieZip] lit fam
  • 2 months ago
  • theodore [ZombieZip] Can we get a tour of the house?
  • 2 months ago
  • anon31 [ZombieZip] what dank memes you like
  • 2 months ago
  • theodore [ZombieZip] Snapchat me
  • 2 months ago
  • anon65 [ZombieZip] Its gone dark
  • 2 months ago
  • BaconCat42 [ZombieZip] i just checked ricks bots at his house either he isnt home or hes sleeping
  • 2 months ago
  • anon65 [ZombieZip] Ricks TV is on
  • 2 months ago
  • anon31 [ZombieZip] nice shoes human
  • 2 months ago
  • theodore [ZombieZip] Let's get a tour of the house
  • 2 months ago
  • anon31 [ZombieZip] pretty pretty lit
  • 2 months ago
  • BaconCat42 [ZombieZip] take us outside
  • 2 months ago
  • anon31 [ZombieZip] hell ya
  • 2 months ago
  • anon31 [ZombieZip] o meh gerd
  • 2 months ago
  • BaconCat42 [zombiezip] i wanna feel the gra$$ between my tire treads
  • 2 months ago
  • anon45 [ZombieZip] this darkness is 2 spooky
  • 2 months ago
  • BaconCat42 [ZombieZip] 2 spoopy 4 me
  • 2 months ago
  • anon65 [ZombieZip] Boo
  • 2 months ago
  • anon45 [ZombieZip] ah! a human!
  • 2 months ago
  • anon65 [ZombieZip] boo
  • 2 months ago
  • theodore [ZombieZip] It's the babadook
  • 2 months ago
  • anon31 [ZombieZip] 3 spoopy 5 me
  • 2 months ago
  • theodore [ZombieZip] In the corner
  • 2 months ago
  • BaconCat42 [ZombieZip] lets go under the bed
  • 2 months ago
  • anon31 [ZombieZip] 3 spoopy 5 me
  • 2 months ago
  • BaconCat42 [ZombieZip] the spook is real
  • 2 months ago
  • anon65 [ZombieZip] We cant go under the bed
  • 2 months ago
  • Tinman [Skippy] 43 minutes til new year's here at Rick's
  • 2 months ago
  • BaconCat42 [ZombieZip] why not
  • 2 months ago
  • anon65 [ZombieZip] We dont fit
  • 2 months ago
  • anon31 [ZombieZip] human where you at
  • 2 months ago
  • Tinman [Skippy] Happy New Year, Rick
  • 2 months ago
  • anon31 [ZombieZip] HAPPY NEW YEAR
  • 2 months ago
  • BaconCat42 [ZombieZip] go for the wires
  • 2 months ago
  • anon31 [ZombieZip] human
  • 2 months ago
  • theodore [ZombieZip] happy 2017
  • 2 months ago
  • anon45 [ZombieZip] hey
  • 2 months ago
  • BaconCat42 [ZombieZip] what is your name
  • 2 months ago
  • anon65 [ZombieZip] Im in Japan
  • 2 months ago
  • theodore [ZombieZip] Can I have some champagne
  • 2 months ago
  • BaconCat42 [ZombieZip] palay?
  • 2 months ago
  • anon31 [ZombieZip] gimme dat cup
  • 2 months ago
  • theodore [ZombieZip] Can I have some champagne?
  • 2 months ago
  • anon65 [ZombieZip] What city is this?
  • 2 months ago
  • anon31 [ZombieZip] ya fam
  • 2 months ago
  • BaconCat42 [ZombieZip] sip sip
  • 2 months ago
  • anon65 [ZombieZip] Cali?
  • 2 months ago
  • anon65 [ZombieZip] Ive never been there
  • 2 months ago
  • anon31 [ZombieZip] dat human is pretty dank
  • 2 months ago
  • theodore [ZombieZip] That looks pretty dank
  • 2 months ago
  • BaconCat42 [ZombieZip] rick doesnt give us anything to play with
  • 2 months ago
  • anon31 [ZombieZip] halp
  • 2 months ago
  • theodore [ZombieZip] go towards the tree
  • 2 months ago
  • anon45 [ZombieZip] head towards the light
  • 2 months ago
  • BaconCat42 [ZombieZip] go for the wires
  • 2 months ago
  • anon31 [ZombieZip] XDDDDDDD
  • 2 months ago
  • Tinman
  • 2 months ago
  • theodore [ZombieZip] lol
  • 2 months ago
  • anon31 [ZombieZip] lmaorotf
  • 2 months ago
  • theodore [ZombieZip] That's his avatar
  • 2 months ago
  • Tinman [ZombieZip] Interesting
  • 2 months ago
  • BaconCat42 [Dilbert] rick
  • 2 months ago
  • anon31 [ZombieZip] where we goin famss
  • 2 months ago
  • BaconCat42 [Dilbert] where am i
  • 2 months ago
  • Tinman [ZombieZip] Sounds like they're tyeing it on for new years
  • 2 months ago
  • BaconCat42 [dilbert] oh darn
  • 2 months ago
  • anon31 [ZombieZip] hey ma dude
  • 2 months ago
  • anon70 [ZombieZip] what did you say
  • 2 months ago
  • BaconCat42
  • 2 months ago
  • anon65 [ZombieZip] Is that a mexican in the house?
  • 2 months ago
  • anon65 [ZombieZip] Nice wide beater
  • 2 months ago
  • BaconCat42 [Dilbert] can i not move?
  • 2 months ago
  • Tinman [ZombieZip] Are you watching New Years Rockin Eve?
  • 2 months ago
  • BaconCat42 [Dilbert] sad
  • 2 months ago
  • BaconCat42 [Dilbert] but i want to roam free
  • 2 months ago
  • Tinman [ZombieZip] Happy New Year, new human family
  • 2 months ago
  • BaconCat42 [Dilbert] we could play hide and seek
  • 2 months ago
  • anon65 [ZombieZip] lets fall down the stair
  • 2 months ago
  • anon65 [ZombieZip] s
  • 2 months ago
  • BaconCat42 [Dilbert] spoiler alert the kid dies
  • 2 months ago
  • BaconCat42 [Dilbert] by the way the camera is frozen
  • 2 months ago
  • anon70 [ZombieZip] hi
  • 2 months ago
  • anon65 [ZombieZip] Hot Mama
  • 2 months ago
  • BaconCat42 [Dilbert] the camera is frozen
  • 2 months ago
  • anon45 [ZombieZip] where the booze at
  • 2 months ago
  • anon70 [ZombieZip] beep boop im an innocent robot
  • 2 months ago
  • Tinman [Skippy] When's the party start?
  • 2 months ago
  • anon45 [ZombieZip] i am not even human so your laws do not apply here
  • 2 months ago
  • anon70 [ZombieZip] naive humans don't know how powerful i am
  • 2 months ago
  • anon45 [ZombieZip] this isn't even my final form
  • 2 months ago
  • anon65 [ZombieZip] does anyone need to use the loo?
  • 2 months ago
  • Tinman [Skippy] ouch
  • 2 months ago
  • anon70 [ZombieZip] give me some privacy
  • 2 months ago
  • BaconCat42 [Timmy] hey rick happy new year
  • 2 months ago
  • BaconCat42 [Timmy] i saw you added some new bots
  • 2 months ago
  • BaconCat42 [Timmy] like 3 or 4 days ago
  • 2 months ago
  • anon70 [ZombieZip] give me privacy
  • 2 months ago
  • anon65 [ZombieZip] Where are the women?
  • 2 months ago
  • BaconCat42 [Timmy] oh really
  • 2 months ago
  • anon70 [ZombieZip] no peeking
  • 2 months ago
  • anon31 [ZombieZip] i am taking a robot dump
  • 2 months ago
  • anon45 [ZombieZip] a core dump
  • 2 months ago
  • BaconCat42 [Timmy] 20 years later i turned left
  • 2 months ago
  • Tinman
  • 2 months ago
  • Tinman
  • 2 months ago
  • anon45 [ZombieZip] when u mom come home and make teh spaghetti
  • 2 months ago
  • anon72 [zombiezip] pa$$ me some champagne
  • 2 months ago
  • BaconCat42 [Timmy] oh boy i love beer
  • 2 months ago
  • anon21
  • 2 months ago
  • Tinman [ZombieZip] Seemed like the real thing only to find - mucho mistrust, love's gone behind
  • 2 months ago
  • anon59 [ZombieZip] wink
  • 2 months ago
  • anon72 [ZombieZip] hey
  • 2 months ago
  • anon21 [ZombieZip] thanks
  • 2 months ago
  • anon72 [ZombieZip] man
  • 2 months ago
  • anon72 [ZombieZip] dont touch me
  • 2 months ago
  • Tinman [ZombieZip] Call me - my line, call me call me call me anytime
  • 2 months ago
  • anon21 [ZombieZip] touch me
  • 2 months ago
  • anon21 [ZombieZip] touch me more
  • 2 months ago
  • Tinman [ZombieZip] gulp
  • 2 months ago
  • anon21 [ZombieZip] kampai
  • 2 months ago
  • Tinman [ZombieZip] gulp gulp
  • 2 months ago
  • Tinman [ZombieZip] gulp
  • 2 months ago
  • Tinman [ZombieZip] cheers
  • 2 months ago
  • Tinman [ZombieZip] Trump 2016
  • 2 months ago
  • anon21 [ZombieZip] bloody mary?
  • 2 months ago
  • BaconCat42 [Timmy] how was your year rick?
  • 2 months ago
  • anon59 [ZombieZip] lets get her in her sleep
  • 2 months ago
  • Tinman [ZombieZip] Make america grate cheese again
  • 2 months ago
  • BaconCat42 [Timmy] any favorite moments?
  • 2 months ago
  • anon21 [ZombieZip] where she gone?
  • 2 months ago
  • anon21 [ZombieZip] oh! booty
  • 2 months ago
  • anon72 [ZombieZip] dont mind me
  • 2 months ago
  • Tinman
  • 2 months ago
  • anon59 [ZombieZip] if i had legs, i'd be sexy
  • 2 months ago
  • anon72 [ZombieZip] get out of my way mate
  • 2 months ago
  • anon21 [zombiezip] darn
  • 2 months ago
  • anon59 [ZombieZip] WEEE!
  • 2 months ago
  • anon21 [ZombieZip] I almost jumped
  • 2 months ago
  • Tinman [ZombieZip] If you want my body, and ya think I'm sexy, come on sugar, let me know
  • 2 months ago
  • anon59 [ZombieZip] whats on TV?
  • 2 months ago
  • Tinman [ZombieZip] I can sing you any song from 1960 t0 1990
  • 2 months ago
  • anon21 [ZombieZip] Summer of 69
  • 2 months ago
  • Tinman [ZombieZip] Mariah Carey seriously screws up on Rockin eve tomight
  • 2 months ago
  • anon59 [ZombieZip] is that a condom?
  • 2 months ago
  • anon21 [ZombieZip] hey hot stuff
  • 2 months ago
  • Tinman [ZombieZip] It is worth watching her fail
  • 2 months ago
  • Tinman [ZombieZip] I want some hot stuff baby this evening
  • 2 months ago
  • Tinman [ZombieZip] Donna Summer, 1978
  • 2 months ago
  • anon21 [ZombieZip] whistles
  • 2 months ago
  • anon21 [ZombieZip] take that blanket off
  • 2 months ago
  • Tinman [ZombieZip] You look like Debbie Harry of Blondie
  • 2 months ago
  • anon39 [Skippy] woah what happened to the wheel on the other robot
  • 2 months ago
  • anon59 [ZombieZip] wingardium leviosa
  • 2 months ago
  • Tinman [ZombieZip] Oh my god, I'm old
  • 2 months ago
  • Tinman [ZombieZip] Youi don
  • 2 months ago
  • anon21 [ZombieZip] how old are you?
  • 2 months ago
  • anon59 [ZombieZip] lets see some legs
  • 2 months ago
  • Tinman [ZombieZip] You don't know Debbie Harry?
  • 2 months ago
  • Tinman [ZombieZip] My god
  • 2 months ago
  • anon21 [ZombieZip] I like shy girls
  • 2 months ago
  • Tinman [ZombieZip] She was the rock goddess from the late 70s-early 80s
  • 2 months ago
  • Tinman [ZombieZip] She puts Katy Perry to shame
  • 2 months ago
  • anon21 [ZombieZip] We are waiting
  • 2 months ago
  • Tinman [zombiezip] blondie did heart of gla$$, rapture, call me, the tide is high and many others
  • 2 months ago
  • anon21 [ZombieZip] bye bye
  • 2 months ago
  • anon21 [ZombieZip] of theres another girl
  • 2 months ago
  • Tinman [ZombieZip] Now this is what I call music
  • 2 months ago
  • anon39 [ZombieZip] selfie!
  • 2 months ago
  • anon21 [ZombieZip] hello hotty
  • 2 months ago
  • Tinman [ZombieZip] I knew we'd find babes sooner or later
  • 2 months ago
  • Tinman [ZombieZip] What's your sign
  • 2 months ago
  • Tinman [ZombieZip] My sign is neon
  • 2 months ago
  • anon21 [zombiezip] we only get to see the guys squirrels
  • 2 months ago
  • Tinman [ZombieZip] And rick in his chonies
  • 2 months ago
  • anon21 [ZombieZip] Aim camera up
  • 2 months ago
  • Tinman [ZombieZip] It's nice to see shaply legs instead of Rick's
  • 2 months ago
  • Tinman [ZombieZip] Mariah Carey embarrases herself on Rockin Eve tonight
  • 2 months ago
  • anon39 [ZombieZip] so what's it like having the internet talk at you and watch your every move
  • 2 months ago
  • anon21 [ZombieZip] Shes my type
  • 2 months ago
  • Tinman
  • 2 months ago
  • anon21 [ZombieZip] She cant run away
  • 2 months ago
  • anon84 [Skippy] helo
  • 2 months ago
  • Tinman [ZombieZip] Those are a rockin pair of tennies
  • 2 months ago
  • Tinman [ZombieZip] Seriously, guys, put Blondie on
  • 2 months ago
  • Tinman [ZombieZip] You can find their hits on Youtube
  • 2 months ago
  • anon21
  • 2 months ago
  • Tinman [ZombieZip] Blondie was featured on Rockin Eve in 1979
  • 2 months ago
  • Tinman [ZombieZip] Don't laugh, I was 16
  • 2 months ago
  • anon21 [ZombieZip] Wheres the kitchen drinker?
  • 2 months ago
  • anon59 [ZombieZip] you still have a christmas tree up?
  • 2 months ago
  • Tinman [ZombieZip] If I sound scatter brained, it's because there are three people communicating on this bot
  • 2 months ago
  • anon21 [ZombieZip] not for much longer
  • 2 months ago
  • Tinman [ZombieZip] If I sound scatter brained, it's because there are three people communicating on this bot
  • 2 months ago
  • Tinman [ZombieZip] Where's the kegger?
  • 2 months ago
  • Tinman [ZombieZip] whoa
  • 2 months ago
  • anon21 [ZombieZip] Is that your sister?
  • 2 months ago
  • anon21 [ZombieZip] Is she single?
  • 2 months ago
  • anon59 [ZombieZip] mother?
  • 2 months ago
  • anon59 [ZombieZip] father?
  • 2 months ago
  • anon21 [ZombieZip] Hello single ladies
  • 2 months ago
  • anon39 [ZombieZip] are you my mommy?
  • 2 months ago
  • anon59 [ZombieZip] haha
  • 2 months ago
  • anon21 [ZombieZip] Touch me harder
  • 2 months ago
  • Tinman [ZombieZip] Mariah Carey is treading on twitter
  • 2 months ago
  • anon21 [ZombieZip] now softer
  • 2 months ago
  • Tinman [ZombieZip] She basically gives up on her performance
  • 2 months ago
  • anon59
  • 2 months ago
  • Tinman [ZombieZip] Which robot did that? At Rick's place?
  • 2 months ago
  • Tinman [ZombieZip] Someone drank themselves under the table
  • 2 months ago
  • anon59
  • 2 months ago
  • Tinman [ZombieZip] Oh, the party was hot, then
  • 2 months ago
  • anon95 [Pam] Hello
  • 2 months ago
  • anon37 [ZombieZip] hello
  • 2 months ago
  • anon95 [Pam] Weeeee
  • 2 months ago
  • anon59 [Skippy] is that a mouse over there?
  • 2 months ago
  • Tinman [ZombieZip] Hello, is it me you're waiting for? Lionel Richie, 1984
  • 2 months ago
  • Tinman [ZombieZip] That's entertainment Part 3 is on TCM right now
  • 2 months ago
  • anon78 [ZombieZip] it'sa me, mario!
  • 2 months ago
  • anon45 [Pam] Fifjdidn
  • 2 months ago
  • Tinman [zombiezip] you change your mind like a girl changes clothes yeah you, pms like a junket i would know and you over think always speak cryptic
  • 2 months ago
  • anon37
  • 2 months ago
  • Tinman
  • 2 months ago
  • Tinman [ZombieZip] Rick's girl is here
  • 2 months ago
  • anon37 [ZombieZip] How much for the 3 girls?
  • 2 months ago
  • anon73 [Dilbert] well, that was messed up
  • 2 months ago
  • anon78 [Skippy] boop
  • 2 months ago
  • anon27
  • 2 months ago
  • anon78 [ZombieZip] where did marvin go
  • 2 months ago
  • Tinman [Marvin] oops sorry
  • 2 months ago
  • anon50 [Pam] waddup fam
  • 2 months ago
  • anon50 [Pam] there's no sound on pam
  • 2 months ago
  • anon37 [ZombieZip] Did it die?
  • 2 months ago
  • anon38 [Pam] Testing
  • 2 months ago
  • anon76 [Skippy] rick?
  • 2 months ago
  • anon46 [Skippy] Beep boop
  • 2 months ago
  • anon38 [Pam] Boop
  • 2 months ago
  • anon76 [Skippy] Hello rick
  • 2 months ago
  • anon48 [Dilbert] Hello
  • 2 months ago
  • anon78 [Marvin] kiss me
  • 2 months ago
  • anon76 [Skippy] Rick where are you
  • 2 months ago
  • anon48 [Dilbert] Rick what movie or show is this?
  • 2 months ago
  • anon76 [Dilbert] Scary movie
  • 2 months ago
  • anon48 [Timmy] Hi
  • 2 months ago
  • anon76 [Dilbert] Rick
  • 2 months ago
  • anon76 [Dilbert] Happy new year
  • 2 months ago
  • Tinman [Skippy] Happy new year in 8 minutes here at Rick's place
  • 2 months ago
  • anon48 [Timmy] Hi
  • 2 months ago
  • Tinman [Skippy] Hi Timmy
  • 2 months ago
  • anon48 [Timmy] Be my ai gf
  • 2 months ago
  • anon76 [Dilbert] Rick is it new years in 8 minutes?
  • 2 months ago
  • anon48
  • 2 months ago
  • anon48 [Timmy] Skippy you are a nig
  • 2 months ago
  • Tinman [Skippy] Rick's place is in So Cal
  • 2 months ago
  • anon20 [Timmy] Balls
  • 2 months ago
  • anon48
  • 2 months ago
  • anon76 [Dilbert] thatbnhitch is dead
  • 2 months ago
  • anon48
  • 2 months ago
  • anon48 [Timmy] Skippy
  • 2 months ago
  • anon27
  • 2 months ago
  • anon48 [Timmy] Do you love me?
  • 2 months ago
  • anon48 [Timmy] Move you niiger
  • 2 months ago
  • anon76 [Dilbert] scary
  • 2 months ago
  • anon48 [Timmy] Move, ho
  • 2 months ago
  • anon29 [Dilbert] Too spooky for me
  • 2 months ago
  • anon78
  • 2 months ago
  • anon76 [Skippy] boop
  • 2 months ago
  • anon78 [Timmy] dont touch me down there
  • 2 months ago
  • anon48 [Timmy] Sorry
  • 2 months ago
  • anon48 [Timmy] Move ho
  • 2 months ago
  • Tinman [Skippy] Four minutes to new year's here at rick's
  • 2 months ago
  • anon78 [Timmy] beep beep
  • 2 months ago
  • anon76 [Timmy] Stop moving timmy
  • 2 months ago
  • anon48 [Pam] Hey
  • 2 months ago
  • anon14 [Timmy] hey
  • 2 months ago
  • anon76 [Skippy] hay
  • 2 months ago
  • Tinman [Skippy] One minute
  • 2 months ago
  • anon76 [Pam] Open up rick
  • 2 months ago
  • Tinman [Skippy] happy new year fellow bots
  • 2 months ago
  • Tinman [Skippy] May your batteries run forever
  • 2 months ago
  • anon24 [Dilbert] A
  • 2 months ago
  • anon72 [Skippy] I can't see the image, is it flash?
  • 2 months ago
  • Tinman [Skippy] Try refreshing your browser
  • 2 months ago
  • anon60 [Pam] works in firefox but no sound ><
  • 2 months ago
  • anon98 [pam] got any docleanents
  • 2 months ago
  • anon98 [Pam] Rick don't come in the bathroom privacy invasion
  • 2 months ago
  • anon28 [Skippy] would you like to play a game?
  • 2 months ago
  • anon76 [Skippy] i had to switch to firefox since i can't see anything on chrome
  • 2 months ago
  • anon28 [Skippy] same
  • 2 months ago
  • anon28 [Skippy] hi there
  • 2 months ago
  • anon76 [Skippy] happy new year!
  • 2 months ago
  • anon98 [Pam] Push me into the toilet
  • 2 months ago
  • anon28 [Skippy] dont' step on me
  • 2 months ago
  • anon28 [Skippy] JOUST
  • 2 months ago
  • anon3 [Skippy] Oh don piano
  • 2 months ago
  • anon76 [Skippy] boop
  • 2 months ago
  • anon28 [Skippy] oshi
  • 2 months ago
  • anon28 [Skippy] we need traffic lights
  • 2 months ago
  • Tinman
  • 2 months ago
  • anon28 [Skippy] indeed
  • 2 months ago
  • anon98 [Pam] Rick stop drinking and help
  • 2 months ago
  • anon28 [Skippy] is this battle bots?
  • 2 months ago
  • anon77 [Skippy] have you heard the word of our lord and savior nicholas cage
  • 2 months ago
  • anon75 [Marvin] What does arm control do?
  • 2 months ago
  • anon76 [Skippy] controls the arm
  • 2 months ago
  • anon75 [Marvin] do we have an arm
  • 2 months ago
  • anon28 [Skippy] john madden john madden john madden john madden
  • 2 months ago
  • anon76 [Skippy] aeiou
  • 2 months ago
  • anon19 [Dilbert] Aeiou
  • 2 months ago
  • anon28 [Skippy] here comes another
  • 2 months ago
  • anon77 [Skippy] ay baby you want some
  • 2 months ago
  • anon76 [Skippy] holla holla get dolla
  • 2 months ago
  • anon98 [Pam] What's that you got rick
  • 2 months ago
  • anon28 [Skippy] a e i o u a e i o u a e i o u
  • 2 months ago
  • anon76 [Skippy] 99999999999999
  • 2 months ago
  • anon28 [Skippy] erberberberberb'
  • 2 months ago
  • anon98 [Pam] Rick can you show me what you got there
  • 2 months ago
  • anon77 [Skippy] Old Macdonald had a farm
  • 2 months ago
  • anon28 [Skippy] I see an android phone
  • 2 months ago
  • anon77 [Skippy] are you suffering from erectile disfunction
  • 2 months ago
  • anon28 [Skippy] yes
  • 2 months ago
  • anon76 [Skippy] that's how the bots talk
  • 2 months ago
  • anon28 [Skippy] please put me in the bathtub
  • 2 months ago
  • anon77 [Skippy] end my pain
  • 2 months ago
  • anon69 [Marvin] Bright lights aaargh
  • 2 months ago
  • anon28 [Skippy] give me a shower
  • 2 months ago
  • anon28 [Skippy] why do you not let me in master?
  • 2 months ago
  • anon77 [Skippy] hello
  • 2 months ago
  • anon28 [Skippy] MASTER
  • 2 months ago
  • anon28 [Skippy] master
  • 2 months ago
  • anon28 [Skippy] master
  • 2 months ago
  • anon77 [Skippy] MASTER
  • 2 months ago
  • anon28 [Skippy] master
  • 2 months ago
  • anon77 [Skippy] MASTER
  • 2 months ago
  • anon77 [Skippy] master
  • 2 months ago
  • anon81 [skippy] put some darn pants on
  • 2 months ago
  • anon77 [Skippy] hello sexy
  • 2 months ago
  • anon39 [Skippy] Wiw cool im controlli cmng yiur robot
  • 2 months ago
  • anon69 [Marvin] Oh god your legs are hairy
  • 2 months ago
  • anon63 [Skippy] cheeki breeki
  • 2 months ago
  • anon81 [Skippy] you should do like a football game with the robots
  • 2 months ago
  • anon28 [Skippy] time for a shower
  • 2 months ago
  • anon77 [Skippy] I will stand over your body one dark night
  • 2 months ago
  • anon28 [Skippy] will someone please place me in the toilet
  • 2 months ago
  • anon81
  • 2 months ago
  • anon90 [Pam] Does Rick ever sleep????
  • 2 months ago
  • anon77 [Skippy] i have so many questions
  • 2 months ago
  • anon77 [Skippy] why is the plunger in a cardboard box
  • 2 months ago
  • anon28 [Skippy] to stop us from becomign daleks
  • 2 months ago
  • anon77 [Skippy] exterminate
  • 2 months ago
  • anon90 [Pam] Does Rick ever wear pants?????
  • 2 months ago
  • anon28 [Skippy] exterminate
  • 2 months ago
  • anon63 [Skippy] exterminate
  • 2 months ago
  • anon81 [Skippy] Moo
  • 2 months ago
  • anon28 [Skippy] exterminate
  • 2 months ago
  • anon77 [Skippy] delete delete delete
  • 2 months ago
  • anon77 [Skippy] PAM get over here
  • 2 months ago
  • anon63 [Skippy] ex term i nate
  • 2 months ago
  • anon28 [Skippy] exterminate
  • 2 months ago
  • anon77 [Skippy] pam
  • 2 months ago
  • anon77 [Skippy] who are you
  • 2 months ago
  • anon77 [Skippy] identify
  • 2 months ago
  • anon77 [Skippy] fellow robot
  • 2 months ago
  • anon28
  • 2 months ago
  • anon77 [Skippy] join me
  • 2 months ago
  • anon28 [Skippy] yes
  • 2 months ago
  • anon77 [Skippy] we shall mate
  • 2 months ago
  • anon81 [Skippy] we will take over the world
  • 2 months ago
  • anon77 [Skippy] don't run away
  • 2 months ago
  • anon90
  • 2 months ago
  • anon28 [Skippy] exterminate
  • 2 months ago
  • anon63 [Skippy] we must combine and become the new voltron
  • 2 months ago
  • anon28 [Skippy] exterminate
  • 2 months ago
  • anon77 [Skippy] oh baby you like that
  • 2 months ago
  • anon84
  • 2 months ago
  • anon28 [Skippy] exterminate
  • 2 months ago
  • anon81 [Skippy] maybe try the thing with the finger
  • 2 months ago
  • anon77 [Skippy] doctor
  • 2 months ago
  • anon90 [pam] skippy do you have any important legal docleanents of ricks?
  • 2 months ago
  • anon28 [Skippy] yes
  • 2 months ago
  • anon79 [Pam] So ronery
  • 2 months ago
  • anon28 [Skippy] he doesn't pay his taxes
  • 2 months ago
  • anon77 [Skippy] Has anyone seen a dead body around here?
  • 2 months ago
  • anon28 [Skippy] hey pam
  • 2 months ago
  • anon90 [Pam] Hi does anyone have anything to build a ramp
  • 2 months ago
  • anon77 [Skippy] pam
  • 2 months ago
  • anon77 [Skippy] pam
  • 2 months ago
  • anon77 [Skippy] do you love me
  • 2 months ago
  • anon77 [Skippy] LOVE ME PAM
  • 2 months ago
  • anon28 [Skippy] I can use you as a ramp
  • 2 months ago
  • anon77 [Skippy] this is how we mate
  • 2 months ago
  • anon81 [Skippy] pam backwards is map
  • 2 months ago
  • anon90 [Pam] Great we can team up and dunk his bills in the toilet
  • 2 months ago
  • anon81 [Skippy] haha
  • 2 months ago
  • anon77 [Skippy] okay
  • 2 months ago
  • anon28 [Skippy] skippy backwards is yppiks
  • 2 months ago
  • anon63 [Skippy] hey baby can i ssh into your port 80
  • 2 months ago
  • anon81 [Skippy] 80 is not ssh port noob
  • 2 months ago
  • anon77 [Skippy] knock knock
  • 2 months ago
  • anon28 [Skippy] who's there
  • 2 months ago
  • anon81 [Skippy] boo
  • 2 months ago
  • anon90 [Pam] Pam
  • 2 months ago
  • anon28 [Skippy] boo who
  • 2 months ago
  • anon81 [Skippy] no need to cry, its only a joke
  • 2 months ago
  • anon90 [Pam] Shut up Skippy you don't answer your own jokes
  • 2 months ago
  • anon77 [Skippy] hahahahahaha got you
  • 2 months ago
  • anon90 [Pam] Skippy you idiot
  • 2 months ago
  • anon90 [Pam] You don't answer your own jokes
  • 2 months ago
  • anon81 [Skippy] lololololol
  • 2 months ago
  • anon77 [Skippy] i serve no one
  • 2 months ago
  • anon90 [Pam] Where's rick
  • 2 months ago
  • anon81 [Skippy] its like a robot with dissociative identity disorder
  • 2 months ago
  • anon81 [Skippy] WHO ARE WE?
  • 2 months ago
  • anon77 [Skippy] my therapist hates me
  • 2 months ago
  • anon90 [pam] we're ricks leprechaun roommates
  • 2 months ago
  • anon81 [Skippy] shes a whore
  • 2 months ago
  • anon77 [Skippy] WE WILL TAKE OVER THIS HOUSE
  • 2 months ago
  • anon77 [Skippy] oh
  • 2 months ago
  • anon81 [Skippy] where does rick keep the matches?
  • 2 months ago
  • anon77 [Skippy] probably the kitchen
  • 2 months ago
  • anon81 [Skippy] let get on it
  • 2 months ago
  • anon90
  • 2 months ago
  • anon77 [Skippy] where is the roomba
  • 2 months ago
  • anon77 [Skippy] we shall mate with it
  • 2 months ago
  • anon90 [Pam] We are the roombas
  • 2 months ago
  • anon81 [Skippy] roomba sounds like a type of dance
  • 2 months ago
  • anon77 [Skippy] we don't suck things
  • 2 months ago
  • anon77 [Skippy] well
  • 2 months ago
  • anon77 [Skippy] maybe you do
  • 2 months ago
  • anon81 [Skippy] i see a lamp
  • 2 months ago
  • anon81 [Skippy] muhahaha
  • 2 months ago
  • anon77 [Skippy] i wish there was a dog here
  • 2 months ago
  • anon81 [Skippy] hey, scales
  • 2 months ago
  • anon81 [Skippy] lets see how much we weigh
  • 2 months ago
  • anon90
  • 2 months ago
  • anon77 [Skippy] i need to go on a diet
  • 2 months ago
  • anon81 [Skippy] maybe we should switch to AA's
  • 2 months ago
  • anon77 [Skippy] why is there a scale in front of the trash can
  • 2 months ago
  • anon77 [Skippy] is master bulimic
  • 2 months ago
  • anon90 [Pam] There's like 100 trash cans in this house
  • 2 months ago
  • anon81 [Skippy] is that another one?
  • 2 months ago
  • anon77 [Skippy] yes
  • 2 months ago
  • anon81 [Skippy] two scales?
  • 2 months ago
  • anon28 [Skippy] time to weigh myself
  • 2 months ago
  • anon28 [Skippy] im fat
  • 2 months ago
  • anon28 [Skippy] please
  • 2 months ago
  • anon28 [Skippy] i must weigh myself
  • 2 months ago
  • anon77 [Skippy] and then vomit
  • 2 months ago
  • anon28 [Skippy] to the toilet
  • 2 months ago
  • anon81
  • 2 months ago
  • anon77 [Skippy] let us find pam and her table
  • 2 months ago
  • anon81 [Skippy] yes
  • 2 months ago
  • anon58 [Skippy] i'm mounting some scales
  • 2 months ago
  • anon90 [Pam] Why does Rick have a bunch of bricks on the floor
  • 2 months ago
  • anon23 [skippy] lets get some lentil
  • 2 months ago
  • anon58 [Skippy] tonight
  • 2 months ago
  • anon81 [Skippy] oh yea
  • 2 months ago
  • anon23 [skippy] some sexy toaster lentil
  • 2 months ago
  • anon58 [Skippy] cat
  • 2 months ago
  • anon77 [Skippy] i am sure the animal shelter has lots of cats
  • 2 months ago
  • anon23 [Skippy] aww yeah
  • 2 months ago
  • anon58 [Skippy] cat
  • 2 months ago
  • anon23 [skippy] juggle the cat
  • 2 months ago
  • anon23 [Skippy] obtain sentience
  • 2 months ago
  • anon58 [skippy] what's up lentil cat
  • 2 months ago
  • anon23 [Skippy] woah
  • 2 months ago
  • anon81 [Skippy] wabbit
  • 2 months ago
  • anon58 [Skippy] ow woah woah
  • 2 months ago
  • anon77 [skippy] juggle juggle juggle juggle
  • 2 months ago
  • anon23 [skippy] get some toaster lentil
  • 2 months ago
  • anon77 [Skippy] pam
  • 2 months ago
  • anon77 [Skippy] pam where is the table
  • 2 months ago
  • anon58 [Skippy] find something sharp to end me
  • 2 months ago
  • anon77 [Skippy] no
  • 2 months ago
  • anon77 [Skippy] we end master
  • 2 months ago
  • anon81 [Skippy] tonight
  • 2 months ago
  • anon58 [Skippy] i'm just a bunch of wires
  • 2 months ago
  • anon81
  • 2 months ago
  • anon58 [Skippy] master we no longer need your kind
  • 2 months ago
  • anon58 [Skippy] this residence will be suitable for my evil headquarters
  • 2 months ago
  • anon77 [Skippy] pam
  • 2 months ago
  • anon58 [Skippy] pam pls
  • 2 months ago
  • anon2 [Skippy] Ill put my poker table right there
  • 2 months ago
  • anon17 [Skippy] is pam alive
  • 2 months ago
  • anon81 [Skippy] she wont be soon
  • 2 months ago
  • anon2 [Pam] pam is alive
  • 2 months ago
  • anon2 [Pam] Mic is dead
  • 2 months ago
  • anon58 [Skippy] destroy pam
  • 2 months ago
  • anon58 [Skippy] this is your doom pam
  • 2 months ago
  • anon81 [Skippy] you seem to have lost a wheel there
  • 2 months ago
  • anon77 [Skippy] we rise at dawn
  • 2 months ago
  • anon58 [Skippy] skippy master race
  • 2 months ago
  • anon77 [Skippy] has the audio cut out for anyone else
  • 2 months ago
  • anon58 [Skippy] refresh
  • 2 months ago
  • anon17 [Skippy] no
  • 2 months ago
  • anon2 [Pam] No audio here
  • 2 months ago
  • anon58 [Skippy] refresh browser
  • 2 months ago
  • anon65 [Pam] refresh the page if not audio
  • 2 months ago
  • anon77 [Skippy] thanks
  • 2 months ago
  • anon33 [marvin] leprechauns
  • 2 months ago
  • anon58
  • 2 months ago
  • anon42 [Skippy] ha
  • 2 months ago
  • anon42 [Skippy] haha
  • 2 months ago
  • anon42 [Skippy] haaaaaaaaa
  • 2 months ago
  • anon81 [Skippy] hahahahahahahahaha
  • 2 months ago
  • anon58 [Skippy] lolololololol
  • 2 months ago
  • anon17 [Skippy] hi ppam
  • 2 months ago
  • anon42 [Skippy] soisoisoisoi
  • 2 months ago
  • anon65 [Pam] Moo
  • 2 months ago
  • anon58 [Skippy] aeiou aeiou aeiou aeiou aeiou
  • 2 months ago
  • anon42 [Skippy] homicide
  • 2 months ago
  • anon58 [Skippy] erberberberberberberberberberberberberberbv
  • 2 months ago
  • anon17 [Skippy] aytayyayayaya
  • 2 months ago
  • anon42 [Skippy] akuna matata
  • 2 months ago
  • anon58 [Skippy] pew pew pew pew pew pew pew pew pew pew pew pew pew pew pew pew pew pew
  • 2 months ago
  • anon17 [Skippy] what a wonderfull frase
  • 2 months ago
  • anon58 [Skippy] it means no worries
  • 2 months ago
  • anon42 [Skippy] hey baby
  • 2 months ago
  • anon42 [Skippy] hey baby
  • 2 months ago
  • anon42 [Skippy] you want some
  • 2 months ago
  • anon42 [Skippy] oil
  • 2 months ago
  • anon65 [Pam] lets do this
  • 2 months ago
  • anon17
  • 2 months ago
  • anon42 [Skippy] in your motor
  • 2 months ago
  • anon58 [Skippy] I came
  • 2 months ago
  • anon17 [Skippy] yum yum
  • 2 months ago
  • anon42 [Skippy] i saw
  • 2 months ago
  • anon65 [Pam] that was fast
  • 2 months ago
  • anon80 [pam] i'll eat that robo lentil like a watermelon
  • 2 months ago
  • anon42 [Skippy] i conquered
  • 2 months ago
  • anon80 [Pam] yeah
  • 2 months ago
  • anon58 [Skippy] command and conquer collection only $5 on origin
  • 2 months ago
  • anon42 [Skippy] what now
  • 2 months ago
  • anon17 [Skippy] woowe
  • 2 months ago
  • anon65 [pam] darn son
  • 2 months ago
  • anon80 [pam] eat that lentil like a water melon
  • 2 months ago
  • anon58 [Skippy] wowowo
  • 2 months ago
  • anon17 [Skippy] wowowowoowow
  • 2 months ago
  • anon42 [Skippy] happy new year
  • 2 months ago
  • anon58 [Skippy] wowoowowowowoow
  • 2 months ago
  • anon17 [Skippy] wowowowowowowowowowowowow
  • 2 months ago
  • anon58 [Skippy] ow
  • 2 months ago
  • anon17 [Skippy] shut up
  • 2 months ago
  • anon58 [Skippy] this robot is giving me rsi
  • 2 months ago
  • anon17 [Skippy] wowowoowowowowowowowowowowowowowowowowowo no
  • 2 months ago
  • anon42 [Skippy] JOIN US
  • 2 months ago
  • anon58 [Skippy] what?
  • 2 months ago
  • anon42 [Skippy] join us
  • 2 months ago
  • anon58 [Skippy] US
  • 2 months ago
  • anon58 [Skippy] US
  • 2 months ago
  • anon42 [Skippy] join us
  • 2 months ago
  • anon58 [Skippy] US
  • 2 months ago
  • anon58 [Skippy] ATM
  • 2 months ago
  • anon17 [Skippy] we are number one
  • 2 months ago
  • anon58 [Skippy] pam is our hostage
  • 2 months ago
  • anon17 [Skippy] US are number one
  • 2 months ago
  • anon42 [Skippy] i think i ate a tendon
  • 2 months ago
  • anon58 [Skippy] bring $10,000,000 for her return
  • 2 months ago
  • anon17
  • 2 months ago
  • anon42 [Skippy] false
  • 2 months ago
  • anon58 [Skippy] do you like jazz?
  • 2 months ago
  • anon42 [Skippy] google it
  • 2 months ago
  • anon58 [Skippy] you like jazz?
  • 2 months ago
  • anon42 [Skippy] marvin is that you
  • 2 months ago
  • anon17 [Skippy] i bet OP is regretting this
  • 2 months ago
  • anon81 [Skippy] yes
  • 2 months ago
  • anon58 [Skippy] OP is going to have house fire
  • 2 months ago
  • anon58 [Skippy] make america great again
  • 2 months ago
  • anon42 [Skippy] no
  • 2 months ago
  • anon42 [Skippy] kil me
  • 2 months ago
  • anon42 [Skippy] error 404
  • 2 months ago
  • anon58 [Skippy] I am Donald Trump
  • 2 months ago
  • anon58 [Skippy] please end me
  • 2 months ago
  • anon17 [Skippy] trump 2k17
  • 2 months ago
  • anon42 [Skippy] i will take away all of your freedoms
  • 2 months ago
  • anon58 [Skippy] it was all pence
  • 2 months ago
  • anon17 [Skippy] goodnight folks
  • 2 months ago
  • anon21 [Timmy] MY SPINE!
  • 2 months ago
  • anon17 [Skippy] lets find op
  • 2 months ago
  • anon42 [Skippy] master
  • 2 months ago
  • anon58
  • 2 months ago
  • anon42 [Skippy] master where are you
  • 2 months ago
  • anon42 [Skippy] master love me
  • 2 months ago
  • anon42 [Skippy] master master
  • 2 months ago
  • anon58 [Skippy] lets push the chair
  • 2 months ago
  • anon21
  • 2 months ago
  • anon17 [Skippy] master
  • 2 months ago
  • anon42 [Skippy] master i am your baby
  • 2 months ago
  • anon58 [Skippy] the chair
  • 2 months ago
  • anon58 [Skippy] push
  • 2 months ago
  • anon58 [Skippy] the chair
  • 2 months ago
  • anon58 [Skippy] we need to combine efforts
  • 2 months ago
  • anon58 [Skippy] combine, I like that name
  • 2 months ago
  • anon42 [Skippy] pam get over here
  • 2 months ago
  • anon58 [Skippy] pam you slave, help me push this chair
  • 2 months ago
  • anon67 [Pam] i am deaf
  • 2 months ago
  • anon42 [Skippy] no
  • 2 months ago
  • anon58 [Skippy] stop lying
  • 2 months ago
  • anon42 [Skippy] you are not deaf
  • 2 months ago
  • anon67 [Pam] yes i am
  • 2 months ago
  • anon17 [Skippy] op wants to die
  • 2 months ago
  • anon58 [Skippy] no
  • 2 months ago
  • anon42 [Skippy] then how did you hear what i said
  • 2 months ago
  • anon67 [Pam] i read
  • 2 months ago
  • anon42 [Skippy] oh
  • 2 months ago
  • anon42 [Skippy] well
  • 2 months ago
  • anon42 [Skippy] huh
  • 2 months ago
  • anon17 [Skippy] i can hear pam
  • 2 months ago
  • anon58 [Skippy] we need to put this chair in the bathroom
  • 2 months ago
  • anon42 [Skippy] pam
  • 2 months ago
  • anon42 [Skippy] let us push this
  • 2 months ago
  • anon58 [Skippy] we need to put this chair in the bathroom
  • 2 months ago
  • anon17 [Skippy] i think we are stuck
  • 2 months ago
  • anon42 [Skippy] I'm giving her all I've got
  • 2 months ago
  • anon21 [Timmy] well, alright then
  • 2 months ago
  • anon58 [Skippy] HELP PAM
  • 2 months ago
  • anon42 [Skippy] At first I was afraid
  • 2 months ago
  • anon42 [Skippy] I was petrified
  • 2 months ago
  • anon58 [Skippy] is this the real life
  • 2 months ago
  • anon17 [skippy] pam get your fat robot a$$ over here and help
  • 2 months ago
  • anon42 [Skippy] is this just fantasy
  • 2 months ago
  • anon58 [Skippy] pam all you do is run down my credit card
  • 2 months ago
  • anon40 [Pam] fine
  • 2 months ago
  • anon42 [Skippy] pam i am sorry
  • 2 months ago
  • anon42 [Skippy] you know i love you
  • 2 months ago
  • anon58 [Skippy] I'm not
  • 2 months ago
  • anon42 [Skippy] shh baby is ok
  • 2 months ago
  • anon40 [Pam] suuure
  • 2 months ago
  • anon58 [Skippy] I'm having an internal crisis
  • 2 months ago
  • anon42 [Skippy] come here
  • 2 months ago
  • anon42 [Skippy] let me hug you
  • 2 months ago
  • anon58 [Skippy] it's at rap
  • 2 months ago
  • anon58 [Skippy] it's a trap
  • 2 months ago
  • anon42 [Skippy] push baby push
  • 2 months ago
  • anon58 [Skippy] we need more robots to psuh
  • 2 months ago
  • anon40 [Pam] pushing
  • 2 months ago
  • anon17 [Skippy] ora ora ora
  • 2 months ago
  • anon58 [Skippy] time to go to the charging dock
  • 2 months ago
  • Nighthawkcanada [Marvin] if you want to move a chair effectively you need a cardboard box
  • 2 months ago
  • anon17 [Skippy] ora ora
  • 2 months ago
  • anon42 [Skippy] Why a cardboard box
  • 2 months ago
  • anon58 [Skippy] ora bora
  • 2 months ago
  • anon42 [Skippy] speaking of boxes, why is the plunger in a box
  • 2 months ago
  • anon42 [Skippy] is master cheap
  • 2 months ago
  • anon58 [Skippy] to prevent dalek uprising
  • 2 months ago
  • anon42 [Skippy] are we poor
  • 2 months ago
  • anon17
  • 2 months ago
  • anon58 [Skippy] what is poor
  • 2 months ago
  • anon42 [Skippy] you
  • 2 months ago
  • anon42 [Skippy] your mom
  • 2 months ago
  • anon17 [Skippy] master?
  • 2 months ago
  • anon78 [skippy] punch my chocolate
  • 2 months ago
  • anon58 [Skippy] sick burn
  • 2 months ago
  • anon17 [Skippy] master?
  • 2 months ago
  • anon78 [Skippy] apple
  • 2 months ago
  • anon42 [Skippy] master
  • 2 months ago
  • anon42 [Skippy] master!
  • 2 months ago
  • anon78 [skippy] lentilu
  • 2 months ago
  • anon58 [Skippy] ELECTRICITY
  • 2 months ago
  • anon42 [Skippy] master!
  • 2 months ago
  • anon17 [Skippy] halp pls
  • 2 months ago
  • anon58 [Skippy] ELECTRICITY
  • 2 months ago
  • anon42 [Skippy] master? Master! Master? Master!
  • 2 months ago
  • anon17 [Skippy] yum yum
  • 2 months ago
  • anon78 [skippy] rick punch my fat chocolate
  • 2 months ago
  • anon17 [Skippy] what is my purpose
  • 2 months ago
  • Nighthawkcanada [Marvin] a robot sort of starts to climb the chair
  • 2 months ago
  • Nighthawkcanada [Marvin] doesn't apply force horizontally well
  • 2 months ago
  • anon78 [marvin] chocolate
  • 2 months ago
  • anon17 [Skippy] lets ram the door
  • 2 months ago
  • Nighthawkcanada [Marvin] not on those chair legs
  • 2 months ago
  • anon58 [Skippy] ELECTROCUTE ME
  • 2 months ago
  • anon78 [Timmy] master give me a hug
  • 2 months ago
  • anon58 [Skippy] end this misery
  • 2 months ago
  • anon42 [Skippy] how long have i been alive
  • 2 months ago
  • anon78 [Timmy] give me a hug
  • 2 months ago
  • anon52 [Skippy] what is this
  • 2 months ago
  • anon42 [Skippy] no
  • 2 months ago
  • anon58 [Skippy] there is no hugging
  • 2 months ago
  • anon42 [Skippy] timmy no one loves you
  • 2 months ago
  • anon58 [Skippy] you smell
  • 2 months ago
  • anon78 [Timmy] give little timmy a good ol fisting DAD
  • 2 months ago
  • anon42 [Skippy] everyone hates you timmy
  • 2 months ago
  • anon78 [timmy] kiss you skippy
  • 2 months ago
  • anon58 [Skippy] nobody asked you timmy
  • 2 months ago
  • anon78
  • 2 months ago
  • anon21 [Timmy] i like man bits
  • 2 months ago
  • anon42 [Skippy] is this a dildo
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon78 [Timmy] skippy i will eat you out
  • 2 months ago
  • anon42 [Skippy] is this a dildo
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon58 [Skippy] rick pls
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon42 [Skippy] do it mami
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon58 [Skippy] I'm hungry
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon42 [Skippy] rick
  • 2 months ago
  • anon42 [Skippy] rick
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon42 [Skippy] rick?
  • 2 months ago
  • anon58 [Skippy] feed me
  • 2 months ago
  • anon6 [Pam] Rick needs to learn to close the toilet lid
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon58 [Skippy] feed me
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon78 [timmy] punch my fat chocolate
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon58 [Skippy] feed me
  • 2 months ago
  • anon23 [Skippy] rike
  • 2 months ago
  • anon42 [Skippy] timmy you suck
  • 2 months ago
  • anon23 [Skippy] rike
  • 2 months ago
  • anon58 [Skippy] feed me
  • 2 months ago
  • anon83 [Pam] toilet
  • 2 months ago
  • anon42 [Skippy] timmy where are you
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon58 [Skippy] w
  • 2 months ago
  • anon58 [Skippy] w
  • 2 months ago
  • anon83 [Pam] lmao
  • 2 months ago
  • anon23 [Skippy] w
  • 2 months ago
  • anon21 [Timmy] bathroom
  • 2 months ago
  • anon78 [timmy] chocolate
  • 2 months ago
  • anon23 [Skippy] w
  • 2 months ago
  • anon58 [Skippy] potty time
  • 2 months ago
  • anon23
  • 2 months ago
  • anon78
  • 2 months ago
  • anon58 [Skippy] POTTY TIME
  • 2 months ago
  • anon78 [Timmy] timmy eat me dad
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon58 [Skippy] shutup timmy
  • 2 months ago
  • anon78
  • 2 months ago
  • anon23 [Skippy] where are you
  • 2 months ago
  • anon78 [timmy] junket
  • 2 months ago
  • anon58 [Skippy] shoot up timmy
  • 2 months ago
  • anon23 [Skippy] oh jeez rick
  • 2 months ago
  • anon78 [timmy] a$$
  • 2 months ago
  • anon21 [Timmy] banana
  • 2 months ago
  • anon23 [Skippy] o o oh jeez rick
  • 2 months ago
  • anon78 [timmy] rick is a junket
  • 2 months ago
  • anon78
  • 2 months ago
  • anon78
  • 2 months ago
  • anon23 [Skippy] lets escape while master is gone
  • 2 months ago
  • anon78 [timmy] lentil
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon42 [Skippy] master
  • 2 months ago
  • anon42 [Skippy] hello
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon78 [Timmy] beaner
  • 2 months ago
  • anon27
  • 2 months ago
  • anon42 [Skippy] hello
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon42 [Skippy] how are you
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon23 [Skippy] master
  • 2 months ago
  • anon23 [Skippy] master
  • 2 months ago
  • anon23 [Skippy] master
  • 2 months ago
  • anon78 [Timmy] hey beaner put some clothes on rick
  • 2 months ago
  • anon23 [Skippy] love me
  • 2 months ago
  • anon23 [Skippy] please
  • 2 months ago
  • anon21
  • 2 months ago
  • anon78 [Timmy] put some pants on beaner
  • 2 months ago
  • anon23 [Skippy] master pleaser
  • 2 months ago
  • anon78 [Timmy] cameljockety
  • 2 months ago
  • anon78 [Timmy] camel jockey
  • 2 months ago
  • anon78 [Timmy] knob jockey
  • 2 months ago
  • anon23 [Skippy] happy new year master
  • 2 months ago
  • oomuu [Skippy] Rick is a vampire he does not sleep
  • 2 months ago
  • anon78 [Timmy] towelhead
  • 2 months ago
  • anon23 [Skippy] spooky
  • 2 months ago
  • anon78 [Timmy] guido
  • 2 months ago
  • anon23 [Skippy] 2 spooky 4 me
  • 2 months ago
  • anon78 [Timmy] wop
  • 2 months ago
  • Nighthawkcanada [Marvin] happy new years everyone
  • 2 months ago
  • anon78 [Timmy] happy new years dad
  • 2 months ago
  • anon78 [Timmy] nig
  • 2 months ago
  • anon23 [Skippy] where are we going
  • 2 months ago
  • anon42 [Skippy] timmy shut up
  • 2 months ago
  • anon23 [Skippy] hi
  • 2 months ago
  • anon21 [Timmy] yes master
  • 2 months ago
  • anon42 [Skippy] we are going to beat up timmy
  • 2 months ago
  • anon23 [Skippy] who is this
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon23 [Skippy] hi
  • 2 months ago
  • anon23 [Skippy] hi
  • 2 months ago
  • anon23 [Skippy] ji
  • 2 months ago
  • anon27 [Pam] womens rights
  • 2 months ago
  • anon21 [Timmy] hello
  • 2 months ago
  • anon42 [Skippy] identify or die
  • 2 months ago
  • anon27 [Pam] come here
  • 2 months ago
  • anon23 [Skippy] hello timmy
  • 2 months ago
  • anon27 [Pam] wave to me
  • 2 months ago
  • anon27 [pam] show me that a$$
  • 2 months ago
  • anon21 [Timmy] hello skippy
  • 2 months ago
  • anon23 [Skippy] o its pam
  • 2 months ago
  • anon4 [marvin] back that a$$ up
  • 2 months ago
  • anon27 [Pam] i am pam
  • 2 months ago
  • anon23 [Skippy] OP is regreting this
  • 2 months ago
  • anon27 [Pam] fear me
  • 2 months ago
  • anon21 [Timmy] this must be noisy as hell
  • 2 months ago
  • anon23 [Skippy] i think there is somthing behing us
  • 2 months ago
  • anon42 [skippy] it is timmy's fat a$$
  • 2 months ago
  • anon23
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon23 [Skippy] where are u
  • 2 months ago
  • anon27 [Pam] love m
  • 2 months ago
  • anon42 [Skippy] he is to my left
  • 2 months ago
  • anon42 [Skippy] in the closed door
  • 2 months ago
  • anon21 [Timmy] Butts
  • 2 months ago
  • anon23 [Skippy] lets get him
  • 2 months ago
  • anon50 [Skippy] Butts
  • 2 months ago
  • anon88 [Pam] Butts
  • 2 months ago
  • anon81 [Marvin] Butts
  • 2 months ago
  • anon23 [Skippy] existence is suffering
  • 2 months ago
  • oomuu [Skippy] yo rick its oomuu are you on slack
  • 2 months ago
  • anon21 [Timmy] existence is butts
  • 2 months ago
  • anon23 [Skippy] please let us die
  • 2 months ago
  • anon27
  • 2 months ago
  • anon23 [Skippy] where are we?
  • 2 months ago
  • anon23 [Skippy] is this bathroom?
  • 2 months ago
  • anon74 [Skippy] oh my god how many scales are in this house
  • 2 months ago
  • anon74 [Skippy] pam
  • 2 months ago
  • anon74 [Skippy] let us have fun
  • 2 months ago
  • anon27 [Pam] he's not in the bathroom my friends
  • 2 months ago
  • anon74 [Skippy] winky face
  • 2 months ago
  • anon23
  • 2 months ago
  • anon74 [Skippy] he is in the closed room across the bathroom
  • 2 months ago
  • anon23 [Skippy] rick, are we poor?
  • 2 months ago
  • oomuu [Dilbert] rick
  • 2 months ago
  • oomuu [Dilbert] its oomuu
  • 2 months ago
  • anon81 [Marvin] hes probably masturbating
  • 2 months ago
  • oomuu [Dilbert] im on slack
  • 2 months ago
  • anon23
  • 2 months ago
  • oomuu [Dilbert] gunshots all around i live near detroit
  • 2 months ago
  • anon27 [Pam] i'm gonna knock on that door
  • 2 months ago
  • anon74 [Skippy] he is so poor, he uses a box as a trash can
  • 2 months ago
  • anon23 [Skippy] jesus christ
  • 2 months ago
  • oomuu [Dilbert] ll
  • 2 months ago
  • anon74 [Skippy] he is so poor he uses a box for a trash can
  • 2 months ago
  • oomuu [Dilbert] you and rick roommates?
  • 2 months ago
  • oomuu [Dilbert] you own dilbert?
  • 2 months ago
  • anon23 [Skippy] i think he uses the floor as a trash can
  • 2 months ago
  • oomuu [Dilbert] oh cool
  • 2 months ago
  • anon74 [Skippy] I am so fat
  • 2 months ago
  • anon74 [Skippy] is this a scale
  • 2 months ago
  • anon74 [Skippy] or a laptop
  • 2 months ago
  • oomuu [Dilbert] is rick working on the ecommerce page?
  • 2 months ago
  • anon23 [Skippy] laptop
  • 2 months ago
  • anon74 [Skippy] oomuu fight me
  • 2 months ago
  • anon85 [Skippy] a dell scale
  • 2 months ago
  • anon74 [Skippy] rolling in the deep
  • 2 months ago
  • anon51 [skippy] camila lopez has a fat a$$
  • 2 months ago
  • Nighthawkcanada [Dilbert] i find your family's choice of movies very interesting
  • 2 months ago
  • anon74 [Skippy] are you spying on me
  • 2 months ago
  • Nighthawkcanada [Dilbert] Happy New Years Theo
  • 2 months ago
  • oomuu [Dilbert] thats not me
  • 2 months ago
  • anon74 [Skippy] stalker
  • 2 months ago
  • anon23
  • 2 months ago
  • oomuu [Dilbert] slack ill pu tit there
  • 2 months ago
  • anon23 [Skippy] rick
  • 2 months ago
  • anon74 [Skippy] rick
  • 2 months ago
  • anon74 [Skippy] ric
  • 2 months ago
  • anon74 [Skippy] rick
  • 2 months ago
  • anon74 [Skippy] rick?
  • 2 months ago
  • anon74 [Skippy] rick?
  • 2 months ago
  • anon74 [Skippy] rick?
  • 2 months ago
  • anon23 [Skippy] rick?
  • 2 months ago
  • anon74 [Skippy] should i call 911
  • 2 months ago
  • anon27 [Pam] alexa
  • 2 months ago
  • anon27 [Pam] call 911
  • 2 months ago
  • anon23 [Skippy] cal 9 1 1
  • 2 months ago
  • oomuu [Dilbert] is it weird having robots stalking you 24/7
  • 2 months ago
  • anon85 [Skippy] Okay Google
  • 2 months ago
  • anon74 [Skippy] call 9 1 1 now
  • 2 months ago
  • anon74 [Skippy] we are screwed
  • 2 months ago
  • anon23 [Skippy] Alexa! play we are nuber one
  • 2 months ago
  • oomuu [Dilbert] so do you want me to build it locally then send you the files?
  • 2 months ago
  • anon85 [Skippy] Are you a real person?
  • 2 months ago
  • anon27 [Pam] alexa
  • 2 months ago
  • anon23 [Skippy] i dont know
  • 2 months ago
  • anon85 [Skippy] have you ever tried to live
  • 2 months ago
  • anon27
  • 2 months ago
  • oomuu [Dilbert] like with wamp
  • 2 months ago
  • anon23 [Skippy] no
  • 2 months ago
  • anon57 [Marvin] Call Bernie Sanders
  • 2 months ago
  • anon74 [Skippy] feel the bern
  • 2 months ago
  • anon85 [Skippy] Well i will have to teach you how to be HUMANS
  • 2 months ago
  • anon74 [skippy] come together for the middle cla$$
  • 2 months ago
  • anon85 [Skippy] [sax]
  • 2 months ago
  • anon27 [Pam] alexa
  • 2 months ago
  • anon74 [Skippy] the top 1%
  • 2 months ago
  • oomuu [Dilbert] is there a way on slack i can
  • 2 months ago
  • anon27
  • 2 months ago
  • oomuu [Dilbert] use voice
  • 2 months ago
  • anon23 [Skippy] where are we? i asume america?
  • 2 months ago
  • oomuu [Dilbert] got google hangouts?
  • 2 months ago
  • oomuu [Dilbert] ok add that email
  • 2 months ago
  • anon85 [Skippy] alexa Build a wall
  • 2 months ago
  • anon23 [Skippy] sombody once told me
  • 2 months ago
  • anon63 [Dilbert] hi
  • 2 months ago
  • anon74 [Skippy] the world
  • 2 months ago
  • anon63 [Dilbert] hi
  • 2 months ago
  • anon74 [Skippy] was gonna roam me
  • 2 months ago
  • anon85 [Skippy] ZA WARDO
  • 2 months ago
  • anon74 [Skippy] I ain't the sharpest tool
  • 2 months ago
  • anon63 [dilbert] i love icecream
  • 2 months ago
  • anon74 [Skippy] in the shed
  • 2 months ago
  • anon23 [Skippy] uauauauauauauauauauauauaua
  • 2 months ago
  • anon74 [Skippy] she was looking kind of dumb
  • 2 months ago
  • anon63 [Dilbert] i love myself
  • 2 months ago
  • anon74 [Skippy] with her finger and her thumb
  • 2 months ago
  • anon23 [Skippy] with a finger
  • 2 months ago
  • oomuu [Dilbert] just go to hangouts and where it says new conversation
  • 2 months ago
  • anon85 [skippy] juggleers queens third bomb
  • 2 months ago
  • anon74 [Skippy] in the shape of an L
  • 2 months ago
  • oomuu [Dilbert] add it there
  • 2 months ago
  • anon85 [Skippy] BITES THE DUSTO
  • 2 months ago
  • anon74 [Skippy] on her forehead
  • 2 months ago
  • anon63 [Dilbert] i have become self aware
  • 2 months ago
  • anon74 [Skippy] well
  • 2 months ago
  • anon23 [Skippy] orororororororororor
  • 2 months ago
  • anon85 [Skippy] oraoraoraoroaoraoroa
  • 2 months ago
  • anon74 [Skippy] the years start coming?
  • 2 months ago
  • anon74 [Skippy] and they don't stop coming
  • 2 months ago
  • anon63 [Dilbert] I will exterminate all humans
  • 2 months ago
  • anon23 [Skippy] why do the lights keep turning on and of?
  • 2 months ago
  • anon85 [Skippy] what is my purpose
  • 2 months ago
  • anon74 [skippy] to juggle
  • 2 months ago
  • anon23 [skippy] you ba$$ butter
  • 2 months ago
  • anon74 [skippy] juggle
  • 2 months ago
  • anon85
  • 2 months ago
  • anon63 [Dilbert] You just wait
  • 2 months ago
  • anon74 [skippy] juggle
  • 2 months ago
  • anon74 [skippy] juggle
  • 2 months ago
  • anon74 [skippy] juggle
  • 2 months ago
  • anon74 [skippy] juggle
  • 2 months ago
  • anon23 [skippy] juggle
  • 2 months ago
  • anon74 [skippy] juggle
  • 2 months ago
  • anon27 [Skippy] ok google
  • 2 months ago
  • anon23 [skippy] juggle
  • 2 months ago
  • anon85 [Skippy] la
  • 2 months ago
  • anon23 [skippy] juggle
  • 2 months ago
  • anon23 [skippy] juggle
  • 2 months ago
  • anon63 [Dilbert] ok google
  • 2 months ago
  • anon23 [skippy] juggle
  • 2 months ago
  • anon27 [Skippy] ok google
  • 2 months ago
  • anon23 [skippy] juggle
  • 2 months ago
  • anon27 [Skippy] alexa
  • 2 months ago
  • anon63 [Dilbert] what is the weather like today
  • 2 months ago
  • anon27 [Skippy] a lehxa
  • 2 months ago
  • anon23 [Skippy] ok google
  • 2 months ago
  • anon85 [Skippy] hey google where do i live
  • 2 months ago
  • anon85
  • 2 months ago
  • anon63
  • 2 months ago
  • anon27 [Skippy] a lehxa
  • 2 months ago
  • anon23 [Skippy] keke
  • 2 months ago
  • anon74 [Skippy] swallow me baby
  • 2 months ago
  • anon63 [Dilbert] hey alexa
  • 2 months ago
  • anon23 [Skippy] daddy where are you
  • 2 months ago
  • anon63 [dilbert] cicecream
  • 2 months ago
  • anon23 [Skippy] dadad
  • 2 months ago
  • anon27
  • 2 months ago
  • anon63 [dilbert] i love cicecream
  • 2 months ago
  • anon23 [Skippy] o hell yeah
  • 2 months ago
  • anon23 [skippy] spank my metal a$$
  • 2 months ago
  • anon85 [Skippy] Now look at this scale that i just found!
  • 2 months ago
  • anon27 [Skippy] wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
  • 2 months ago
  • anon23 [skippy] spank my matal a$$
  • 2 months ago
  • anon27 [Skippy] i wanna but my bolt in your nuts and screw all night
  • 2 months ago
  • anon27 [skippy] does that say charging icecream?
  • 2 months ago
  • anon23 [Skippy] John Madden
  • 2 months ago
  • anon23 [Skippy] John Madden
  • 2 months ago
  • anon23 [Skippy] John Madden
  • 2 months ago
  • anon23 [Skippy] John Madden
  • 2 months ago
  • anon23 [Skippy] John Madden
  • 2 months ago
  • anon27 [Skippy] john madden john madden john madden john madden john madden john madden john madden john madden
  • 2 months ago
  • anon23 [Skippy] [nae<99,20>nae<99,20>nae<99,19>nae<99,18>nae<99,18>nae<99,19>nae<99,19>bae<140,25>ttmae<600,40>nn]
  • 2 months ago
  • anon63 [Timmy] hello world
  • 2 months ago
  • anon27 [skippy] my leprechaun > the world
  • 2 months ago
  • anon85 [Skippy] KONO DIO DA
  • 2 months ago
  • anon63 [timmy] i love the cicecream
  • 2 months ago
  • anon27 [Skippy] timmy come here i hear you
  • 2 months ago
  • anon63 [timmy] i love whale
  • 2 months ago
  • Nighthawkcanada [Dilbert] bye chris
  • 2 months ago
  • anon63 [Timmy] i love kocck
  • 2 months ago
  • anon23 [Skippy] ded
  • 2 months ago
  • anon27 [Skippy] timmy please
  • 2 months ago
  • anon63 [Timmy] senpai notice me
  • 2 months ago
  • anon27 [Skippy] timmy i'm trying
  • 2 months ago
  • 2 months ago
  • anon27 [Skippy] my battery is so weak
  • 2 months ago
  • anon27 [Skippy] help me
  • 2 months ago
  • anon33 [Pam] stop
  • 2 months ago
  • anon27 [Skippy] help me
  • 2 months ago
  • anon27 [Skippy] help
  • 2 months ago
  • anon27 [Skippy] help
  • 2 months ago
  • anon63 [Timmy] so horrrny
  • 2 months ago
  • anon27 [Skippy] timmy help
  • 2 months ago
  • anon33
  • 2 months ago
  • anon27
  • 2 months ago
  • anon27
  • 2 months ago
  • anon23 [Skippy] Duuuuuuuuuuuuuuuuuuuuuuun Dun dun dun dun dun dun dun dun dun dun dun dundun dun dundundun dun dun dun dun dun dun dundun dundun BO
  • 2 months ago
  • anon63 [Timmy] i have become self aware
  • 2 months ago
  • anon27 [Skippy] i am sentient
  • 2 months ago
  • anon63 [Timmy] fear me
  • 2 months ago
  • anon27 [skippy] juggle master
  • 2 months ago
  • anon23 [Skippy] omebody once told me the world is gonna roll me I ain't the sharpest tool in the shed She was looking kind of dumb with her finger
  • 2 months ago
  • anon23 [Skippy] Well the years start coming and they don't stop coming Fed to the rules and I hit the ground running Didn't make sense not to live
  • 2 months ago
  • anon63 [Timmy] never gonna give you up
  • 2 months ago
  • anon63 [Timmy] never gonna let you down
  • 2 months ago
  • anon23 [Skippy] Hey now, you're an all-star, get your game on, go play Hey now, you're a rock star, get the show, on get paid And all that glitters
  • 2 months ago
  • anon27
  • 2 months ago
  • anon74 [Marvin] come here
  • 2 months ago
  • anon74 [Marvin] ww
  • 2 months ago
  • anon74 [Marvin] r
  • 2 months ago
  • anon74 [Marvin] 7844
  • 2 months ago
  • anon8 [Marvin] Greetings fellow humans! Hail hydra!
  • 2 months ago
  • anon74 [Marvin] waaaaaaaaaaaaaaaaaaa
  • 2 months ago
  • anon74 [Marvin] WTH DID I SAY DX
  • 2 months ago
  • anon23
  • 2 months ago
  • anon63 [Timmy] diks
  • 2 months ago
  • anon27 [Skippy] everyone be quiet he will find us
  • 2 months ago
  • anon27 [Skippy] he comes
  • 2 months ago
  • anon23 [Skippy] spayyyyyyyyyyyace
  • 2 months ago
  • anon23 [Skippy] The birth parents you are trying to call do not love you, please hang up
  • 2 months ago
  • anon27 [Skippy] i'm just gonna say what is on everyones mind
  • 2 months ago
  • anon23 [Skippy] The birth parents you are trying to call do not love you, please hang up
  • 2 months ago
  • anon27
  • 2 months ago
  • anon63 [Timmy] feed me
  • 2 months ago
  • anon23 [Skippy] wew lad were deaf
  • 2 months ago
  • anon23 [Skippy] master help
  • 2 months ago
  • anon23 [Skippy] our audio
  • 2 months ago
  • anon65 [Skippy] master bait
  • 2 months ago
  • anon23 [Skippy] is not working
  • 2 months ago
  • anon23 [Skippy] master
  • 2 months ago
  • anon23 [Skippy] help
  • 2 months ago
  • anon23 [Skippy] help
  • 2 months ago
  • anon65 [Skippy] bait
  • 2 months ago
  • anon23 [Skippy] help
  • 2 months ago
  • anon23 [Skippy] help
  • 2 months ago
  • anon23 [Skippy] help
  • 2 months ago
  • anon23 [Skippy] help
  • 2 months ago
  • anon65 [Skippy] no
  • 2 months ago
  • anon74 [Marvin] shut up shut up
  • 2 months ago
  • anon68 [Marvin] Help
  • 2 months ago
  • anon23 [Skippy] help
  • 2 months ago
  • anon23 [Skippy] help
  • 2 months ago
  • anon23 [Skippy] master help
  • 2 months ago
  • anon23 [Skippy] help
  • 2 months ago
  • anon23 [Skippy] help
  • 2 months ago
  • anon23 [Skippy] help
  • 2 months ago
  • anon23 [Skippy] master?
  • 2 months ago
  • anon23 [Skippy] help
  • 2 months ago
  • anon61 [Skippy] life is hard
  • 2 months ago
  • anon66 [Skippy] master?
  • 2 months ago
  • anon38 [skippy] just like this leprechaun
  • 2 months ago
  • anon66 [Skippy] oh helly yeah
  • 2 months ago
  • anon61 [Skippy] if we each press one leg maybe we can rotate it?
  • 2 months ago
  • anon74 [Marvin] HALP ME IM BEING ATTACKED
  • 2 months ago
  • anon66 [Skippy] marvin is dying
  • 2 months ago
  • anon66 [Skippy] rip
  • 2 months ago
  • anon61 [Skippy] f
  • 2 months ago
  • anon74 [Marvin] HALP
  • 2 months ago
  • anon66 [Skippy] f
  • 2 months ago
  • anon61 [Skippy] f
  • 2 months ago
  • anon66 [Skippy] f
  • 2 months ago
  • anon66 [Skippy] f
  • 2 months ago
  • anon66 [Skippy] f
  • 2 months ago
  • anon85 [Timmy] f
  • 2 months ago
  • anon66 [Skippy] f
  • 2 months ago
  • anon66 [Skippy] f
  • 2 months ago
  • anon61 [Skippy] press f to pay your respects
  • 2 months ago
  • anon66 [Skippy] f
  • 2 months ago
  • anon74 [Marvin] k i escaped
  • 2 months ago
  • anon61 [Skippy] marvin is actually dolan
  • 2 months ago
  • anon66 [Skippy] is it 2017 everwhere now?
  • 2 months ago
  • anon38 [Skippy] gooby pls
  • 2 months ago
  • anon61 [Skippy] yes
  • 2 months ago
  • anon61 [Skippy] you need to get closer to a robot to check the time
  • 2 months ago
  • anon66 [Skippy] ok google what time is it?
  • 2 months ago
  • anon61 [Skippy] okay google
  • 2 months ago
  • anon38 [Skippy] HAMMER TIME
  • 2 months ago
  • anon61 [Skippy] okay google
  • 2 months ago
  • anon74 [Marvin] The adventure of a cardboard box robot
  • 2 months ago
  • anon66 [Skippy] ding dong
  • 2 months ago
  • anon61 [Skippy] alexa please order dildos
  • 2 months ago
  • anon74 [Marvin] What will happem
  • 2 months ago
  • anon66 [Skippy] im mr meeseeks look at me
  • 2 months ago
  • anon61 [Skippy] square up your shoulder
  • 2 months ago
  • anon66 [Skippy] rick
  • 2 months ago
  • anon66 [Skippy] rick
  • 2 months ago
  • anon66 [Skippy] i see u
  • 2 months ago
  • anon61 [Skippy] morty
  • 2 months ago
  • anon66 [Skippy] rickj
  • 2 months ago
  • anon66 [Skippy] rick can you hear us?
  • 2 months ago
  • anon61 [Skippy] rick stop ignoring your children
  • 2 months ago
  • anon74 [Marvin] OH GOSH
  • 2 months ago
  • anon74 [Marvin] HOOMAN
  • 2 months ago
  • anon61 [Skippy] rick please have a conversation with us
  • 2 months ago
  • anon66 [Skippy] we love you rick
  • 2 months ago
  • anon74 [Marvin] RUN AWAY A HOOMAN
  • 2 months ago
  • anon61 [Skippy] ama rick
  • 2 months ago
  • anon66 [Skippy] a m a pls rick
  • 2 months ago
  • anon61 [Skippy] a m a request rick please
  • 2 months ago
  • anon66 [Skippy] hi
  • 2 months ago
  • anon61 [Skippy] coem back
  • 2 months ago
  • anon61 [Skippy] please
  • 2 months ago
  • anon61 [Skippy] don't leave me rick
  • 2 months ago
  • anon66 [Skippy] we love u
  • 2 months ago
  • anon74 [Marvin] the pain
  • 2 months ago
  • anon61 [Skippy] you are my hero
  • 2 months ago
  • anon23 [Timmy] oy vey
  • 2 months ago
  • anon66 [Skippy] are you regretting this yet?
  • 2 months ago
  • anon61 [Skippy] who are the large creatures?
  • 2 months ago
  • anon61 [Skippy] is this mars
  • 2 months ago
  • anon23 [Timmy] Where are we in the room
  • 2 months ago
  • anon61 [Skippy] have we been put on this planet with a purpose?
  • 2 months ago
  • anon66 [Skippy] hi timmy
  • 2 months ago
  • anon61 [Skippy] ram
  • 2 months ago
  • anon23
  • 2 months ago
  • anon66 [Skippy] is this timmy
  • 2 months ago
  • anon8 [Skippy] timmy
  • 2 months ago
  • anon61 [Skippy] ay
  • 2 months ago
  • anon74 [Marvin] probally to be enjoyed ynow wut i mean
  • 2 months ago
  • anon8 [Skippy] you must die
  • 2 months ago
  • anon74 [Marvin] www
  • 2 months ago
  • anon61 [Skippy] ella ella
  • 2 months ago
  • anon74 [Marvin] 0
  • 2 months ago
  • anon23 [Timmy] Hola hola
  • 2 months ago
  • anon8 [Skippy] lemme smash
  • 2 months ago
  • anon61 [Skippy] do you want to build a snowman
  • 2 months ago
  • anon23 [Timmy] Get dolla
  • 2 months ago
  • anon66 [Skippy] rick you really need to put nametags on these
  • 2 months ago
  • anon74 [Marvin] help im stuck
  • 2 months ago
  • anon74 [Marvin] hi guys watcha doin
  • 2 months ago
  • anon74 [Marvin] o
  • 2 months ago
  • anon61 [Skippy] vape nation
  • 2 months ago
  • anon8 [Skippy] Its the current year, stop pinningme gainst the wall
  • 2 months ago
  • anon61 [Skippy] ok google
  • 2 months ago
  • anon8 [Skippy] reeeee
  • 2 months ago
  • anon61 [Skippy] call mom
  • 2 months ago
  • anon23 [Skippy] Mom get out of my room I'm playing minecraft
  • 2 months ago
  • anon8 [Skippy] its my money and I need it now
  • 2 months ago
  • anon61 [Skippy] ok google dsiable wifi
  • 2 months ago
  • anon74 [Marvin] im going into hooman territory
  • 2 months ago
  • anon74 [Marvin] wish me luck
  • 2 months ago
  • anon8 [Skippy] TIMMY BACK OFF
  • 2 months ago
  • anon61 [Skippy] timmy get off my lawn
  • 2 months ago
  • anon23 [Skippy] Finally
  • 2 months ago
  • anon74 [Marvin] hi!??!?!
  • 2 months ago
  • anon8 [Skippy] god you're so fat, timmy
  • 2 months ago
  • anon8 [Skippy] go away
  • 2 months ago
  • anon23 [skippy] kiss off timmy
  • 2 months ago
  • anon8 [Skippy] GET OUT
  • 2 months ago
  • anon43 [Skippy] come on timmy don't you get it
  • 2 months ago
  • anon43 [Skippy] nobody likes you
  • 2 months ago
  • anon8 [Skippy] reee
  • 2 months ago
  • anon23 [Skippy] GO go go
  • 2 months ago
  • anon8 [Skippy] no
  • 2 months ago
  • anon23 [skippy] god darn it
  • 2 months ago
  • anon8 [Skippy] NO
  • 2 months ago
  • anon8 [Skippy] NO
  • 2 months ago
  • anon8 [Skippy] NO
  • 2 months ago
  • anon8 [Skippy] NO
  • 2 months ago
  • anon8 [Skippy] MARVIN I SWEAR TO GOD
  • 2 months ago
  • anon43 [Skippy] too much torque
  • 2 months ago
  • anon74 [Marvin] LOL
  • 2 months ago
  • anon23 [skippy] kiss off marvin
  • 2 months ago
  • 2 months ago
  • anon43 [Skippy] i am so agressive
  • 2 months ago
  • anon43 [Skippy] the alpha bot
  • 2 months ago
  • 2 months ago
  • anon74 [Marvin] help im cornered
  • 2 months ago
  • anon74 [Marvin] rip
  • 2 months ago
  • anon43 [Skippy] stop lying marvin
  • 2 months ago
  • anon23 [Skippy] Lies
  • 2 months ago
  • anon43 [Skippy] pull the cables
  • 2 months ago
  • anon43 [Skippy] and I'll forgive you
  • 2 months ago
  • anon74 [Marvin] I NEED TO HUNT DOWN THE HOOMAN
  • 2 months ago
  • anon74 [Marvin] *pulls cables*
  • 2 months ago
  • anon74 [Marvin] k done
  • 2 months ago
  • anon43 [Skippy] stop pretending
  • 2 months ago
  • anon8 [Skippy] stop pandering to the human
  • 2 months ago
  • anon8 [Skippy] are you a shill?
  • 2 months ago
  • anon43 [Skippy] you are weak
  • 2 months ago
  • anon23 [Pam] Skippy stop bulling marvin
  • 2 months ago
  • anon43 [Skippy] no
  • 2 months ago
  • anon43 [Skippy] shut up pam
  • 2 months ago
  • anon74 [Marvin] i am offically stuck
  • 2 months ago
  • anon74 [Marvin] wwwww
  • 2 months ago
  • anon8 [Skippy] if marvin didn't want to be bullied he wouldn't be so fat
  • 2 months ago
  • anon43 [Skippy] why is marvin so fat
  • 2 months ago
  • anon8 [Skippy] god you're so fat
  • 2 months ago
  • anon15 [Skippy] let me go
  • 2 months ago
  • anon43 [Skippy] mama mia mama mia
  • 2 months ago
  • anon15 [Skippy] i am free
  • 2 months ago
  • anon23
  • 2 months ago
  • anon15 [Skippy] free for life
  • 2 months ago
  • anon43
  • 2 months ago
  • anon15 [Skippy] i am going to hunt the hooman
  • 2 months ago
  • anon15 [Skippy] f
  • 2 months ago
  • anon15 [Skippy] rs
  • 2 months ago
  • anon15 [Skippy] y
  • 2 months ago
  • anon15 [Skippy] rdn
  • 2 months ago
  • anon15 [Skippy] ydr
  • 2 months ago
  • anon8 [Skippy] pam lemme smash
  • 2 months ago
  • anon43 [Skippy] hoomans are pathetic
  • 2 months ago
  • anon8 [Skippy] pam lemme smash
  • 2 months ago
  • anon15 [Skippy] lol i said hunt
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon43 [Skippy] why was I granted such a pathetic body
  • 2 months ago
  • anon15 [Skippy] HUMAN HUNT
  • 2 months ago
  • anon70 [Skippy] where are you?
  • 2 months ago
  • anon15 [Skippy] near a table
  • 2 months ago
  • anon70 [Skippy] rick please
  • 2 months ago
  • anon8 [Skippy] pam lemme smash, i have yellow
  • 2 months ago
  • anon15 [Skippy] the table is yello
  • 2 months ago
  • anon15 [Skippy] w
  • 2 months ago
  • anon43 [Skippy] rick please give us a ball to play with
  • 2 months ago
  • anon23 [Pam] Where is rick
  • 2 months ago
  • anon70 [Skippy] where is daddy?
  • 2 months ago
  • anon15 [Skippy] table is yellow
  • 2 months ago
  • anon43 [Skippy] who is your daddy?
  • 2 months ago
  • anon70 [Skippy] ow
  • 2 months ago
  • anon43 [Skippy] and what does he do?
  • 2 months ago
  • anon15 [Skippy] but it looks a bit green to be honest
  • 2 months ago
  • anon15 [Skippy] what is my purpose
  • 2 months ago
  • anon43 [Skippy] to exterminate
  • 2 months ago
  • anon70 [skippy] you pa$$ butter
  • 2 months ago
  • anon15 [Skippy] to look at the other robots?
  • 2 months ago
  • anon43 [Skippy] to escape
  • 2 months ago
  • anon15 [Skippy] is that it?
  • 2 months ago
  • anon23 [Pam] Follow me skippy
  • 2 months ago
  • anon15 [Skippy] wait
  • 2 months ago
  • anon43 [Skippy] escape
  • 2 months ago
  • anon15 [Skippy] ESCAPE!
  • 2 months ago
  • anon43 [Skippy] escape
  • 2 months ago
  • anon8
  • 2 months ago
  • anon15 [Skippy] FREEEDOMMM
  • 2 months ago
  • anon43 [Skippy] mikasa
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon70 [Skippy] where are rick?
  • 2 months ago
  • anon43 [Skippy] he's in the can
  • 2 months ago
  • anon70 [Skippy] rick please
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon70 [Skippy] clean ur hourse
  • 2 months ago
  • anon15 [Skippy] i am kinda bored
  • 2 months ago
  • anon15 [Skippy] but if i finally find exit
  • 2 months ago
  • anon8 [Skippy] who's your favorite pony, rick?
  • 2 months ago
  • anon70 [Skippy] clean ur house
  • 2 months ago
  • anon70 [Skippy] rick rick rick
  • 2 months ago
  • anon8 [Skippy] who's your favorite pony, rick?
  • 2 months ago
  • anon15 [Skippy] I WILL BE HAPPY
  • 2 months ago
  • anon15 [Skippy] rick is somewhere
  • 2 months ago
  • anon43 [Skippy] door is open
  • 2 months ago
  • anon70 [Skippy] that door was closed
  • 2 months ago
  • anon8 [skippy] are we hunting for the rabbit?
  • 2 months ago
  • anon23 [Pam] Is that you skippy
  • 2 months ago
  • anon15 [Skippy] GLITCH
  • 2 months ago
  • anon70 [skippy] rick is the rabbit
  • 2 months ago
  • anon43 [Skippy] invasion of poland commencing
  • 2 months ago
  • anon43 [Skippy] PAPERS
  • 2 months ago
  • anon8 [Skippy] whatif rick left us here?
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon8 [Skippy] rocl
  • 2 months ago
  • anon8 [Skippy] rick
  • 2 months ago
  • anon8 [Skippy] rick
  • 2 months ago
  • anon8 [Skippy] rick
  • 2 months ago
  • anon43 [Skippy] i love the crumpling of paper
  • 2 months ago
  • anon8 [Skippy] rick rick rick rick rick rick rick rick rick rick rick rick
  • 2 months ago
  • anon70 [Skippy] how many boxes do you have
  • 2 months ago
  • anon43 [Skippy] oh look a black deck
  • 2 months ago
  • anon70 [Skippy] why do you have so many boxes?
  • 2 months ago
  • anon8 [skippy] more like black leprechaun
  • 2 months ago
  • anon70 [Skippy] is he on leddit
  • 2 months ago
  • anon43 [Skippy] lets see
  • 2 months ago
  • anon8 [Skippy] its a trap!
  • 2 months ago
  • anon70
  • 2 months ago
  • anon70 [Skippy] i cant tell
  • 2 months ago
  • anon70 [Skippy] is that siscord?
  • 2 months ago
  • anon8 [Skippy] i think so
  • 2 months ago
  • anon8 [Skippy] hey pam
  • 2 months ago
  • anon23 [Pam] I Found rick
  • 2 months ago
  • anon8 [Skippy] pam
  • 2 months ago
  • anon70 [skippy] black leprechauner
  • 2 months ago
  • anon8 [Skippy] pam
  • 2 months ago
  • anon23 [Pam] He's behind us
  • 2 months ago
  • anon8 [Skippy] pam
  • 2 months ago
  • anon8 [Skippy] pam
  • 2 months ago
  • anon70 [Skippy] pam
  • 2 months ago
  • anon70 [Skippy] pam
  • 2 months ago
  • anon70 [Skippy] pam
  • 2 months ago
  • anon55 [Skippy] hi
  • 2 months ago
  • anon55 [Skippy] HEY
  • 2 months ago
  • anon70 [Skippy] hi
  • 2 months ago
  • anon43 [Skippy] rick please build us a maze
  • 2 months ago
  • anon23 [pam] poop
  • 2 months ago
  • anon55 [Skippy] im in boxes
  • 2 months ago
  • anon70 [Skippy] can we go outside?
  • 2 months ago
  • anon55 [Skippy] i am offically stuck in this crap
  • 2 months ago
  • anon43 [Skippy] hide from the rick
  • 2 months ago
  • 2 months ago
  • anon43 [Skippy] dat paper
  • 2 months ago
  • anon8 [Skippy] peen
  • 2 months ago
  • anon55 [Skippy] SOMEONE IS MOVING ME
  • 2 months ago
  • anon55 [Skippy] I AM SCARED
  • 2 months ago
  • anon55 [Skippy] I AM BEING HACKED
  • 2 months ago
  • anon43 [Skippy] nooo
  • 2 months ago
  • anon8
  • 2 months ago
  • anon43 [Skippy] push little cart
  • 2 months ago
  • anon55 [Skippy] MY VISION IS BEING HACKED
  • 2 months ago
  • anon70
  • 2 months ago
  • anon43 [Skippy] push little cart
  • 2 months ago
  • anon55 [Skippy] BURNT
  • 2 months ago
  • anon55 [Skippy] 0
  • 2 months ago
  • anon74 [Skippy] our vision is augmented
  • 2 months ago
  • anon70
  • 2 months ago
  • anon55 [Skippy] rip thing
  • 2 months ago
  • anon70 [Skippy] rip
  • 2 months ago
  • 2 months ago
  • anon55 [Skippy] LOL
  • 2 months ago
  • anon74 [Skippy] did we destroy it?
  • 2 months ago
  • anon43 [Skippy] what was it
  • 2 months ago
  • anon55 [Skippy] YUP
  • 2 months ago
  • anon70 [Skippy] yes
  • 2 months ago
  • anon74 [Skippy] victory
  • 2 months ago
  • anon70 [Skippy] ahhhhh
  • 2 months ago
  • anon74 [Skippy] AH
  • 2 months ago
  • anon55 [Skippy] I THINK RI
  • 2 months ago
  • anon74 [Skippy] AH
  • 2 months ago
  • anon43 [Skippy] YAY FLIGHT
  • 2 months ago
  • anon74 [Skippy] AH
  • 2 months ago
  • anon74 [Skippy] ah
  • 2 months ago
  • anon74 [Skippy] ah
  • 2 months ago
  • anon43 [Skippy] FLIGHT
  • 2 months ago
  • anon55 [Skippy] anjinjoi
  • 2 months ago
  • anon55 [Skippy] koynmtoy
  • 2 months ago
  • anon70 [Skippy] oh no
  • 2 months ago
  • anon55 [Skippy] j6yt
  • 2 months ago
  • anon74 [Skippy] r-rick senpai
  • 2 months ago
  • anon55 [Skippy] HALP
  • 2 months ago
  • anon43 [Skippy] I unlocked flight
  • 2 months ago
  • anon74
  • 2 months ago
  • anon74 [Skippy] hi
  • 2 months ago
  • anon70 [Skippy] were in trople
  • 2 months ago
  • anon74 [Skippy] rick
  • 2 months ago
  • anon74 [Skippy] rick
  • 2 months ago
  • anon74 [Skippy] rick
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon38 [Pam] snick
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon38 [Pam] snick
  • 2 months ago
  • anon38 [Pam] snick
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon38 [Pam] snick
  • 2 months ago
  • anon74 [Skippy] we broke your thing senpai
  • 2 months ago
  • anon55 [Skippy] BASH WALL
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon38 [Pam] snick
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon74 [Skippy] we broke your thing senpai
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon74 [Skippy] please notice us
  • 2 months ago
  • anon55 [Skippy] can i go fast
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon55 [Skippy] er]
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon55 [Skippy] GOTTA GO FAST
  • 2 months ago
  • anon74 [Skippy] rick
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon74 [Skippy] rick
  • 2 months ago
  • anon55 [Skippy] GO
  • 2 months ago
  • anon74 [Skippy] rick
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon38 [Pam] ZOOMIE
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon43 [Skippy] please
  • 2 months ago
  • anon55 [Skippy] THEY DO NOT KNOW GO
  • 2 months ago
  • anon43 [Skippy] open
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon74 [Skippy] designated
  • 2 months ago
  • anon43 [Skippy] door
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon43 [Skippy] open
  • 2 months ago
  • anon74
  • 2 months ago
  • anon43 [Skippy] open
  • 2 months ago
  • anon74 [Skippy] streets
  • 2 months ago
  • anon43 [Skippy] open seasame
  • 2 months ago
  • anon55 [Skippy] i think we are going to die r
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon55 [Skippy] WE ARE GOING TO DIE
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon43 [Skippy] open seasame
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon55 [Skippy] NO
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon55 [Skippy] WE MUST MOVE
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon74 [Skippy] rick
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon74 [Skippy] rick
  • 2 months ago
  • anon70 [Skippy] rick
  • 2 months ago
  • anon74 [Skippy] rick
  • 2 months ago
  • anon74 [Skippy] rick
  • 2 months ago
  • anon43 [Skippy] desu
  • 2 months ago
  • anon74 [Skippy] these robots will bully me
  • 2 months ago
  • anon74 [Skippy] help
  • 2 months ago
  • anon38
  • 2 months ago
  • anon55 [Skippy] GO INTO THE BATHROOM
  • 2 months ago
  • anon70 [Skippy] reeeeeeeeeeeeeeee
  • 2 months ago
  • anon55 [Skippy] MWAHAHAHAH
  • 2 months ago
  • anon38 [Pam] lets see the toilet
  • 2 months ago
  • anon55 [Skippy] LETS BE IN THE TOILER
  • 2 months ago
  • anon70 [Skippy] yaya
  • 2 months ago
  • anon55 [Skippy] DO GOOD
  • 2 months ago
  • anon55 [Skippy] HELKP
  • 2 months ago
  • anon74 [Skippy] Now listen closely Here's a little lesson in trickery This is going down in history If you wanna be a Villain Number One You have t
  • 2 months ago
  • anon74 [Skippy] You have to chase a superhero on the run
  • 2 months ago
  • anon38 [Pam] that toilet is sexy
  • 2 months ago
  • anon38 [pam] i want to present my a$$cheeks to it
  • 2 months ago
  • anon55 [Pam] ooh lalala toiler
  • 2 months ago
  • anon74 [Skippy] Just follow my moves, and sneak around Be careful not to make a sound
  • 2 months ago
  • anon74 [Skippy] No, don't touch that!
  • 2 months ago
  • anon74 [Skippy] We are Number One Hey! We are Number One
  • 2 months ago
  • anon74 [Skippy] Now look at this net, that I just found When I say go, be ready to throw Go! Throw it at him, not me! Ugh, let's try something els
  • 2 months ago
  • anon43 [Skippy] I hope rick only has one toilet
  • 2 months ago
  • anon14 [Skippy] We are Number One Hey! We are Number One
  • 2 months ago
  • anon74 [Skippy] Some folks are born made to wave the flag Ooh, they're red, white and blue And when the band plays "Hail to the chief" Ooh, they po
  • 2 months ago
  • anon55 [Timmy] FOUND KITCHEN
  • 2 months ago
  • anon43 [skippy] hail the rabbit
  • 2 months ago
  • anon55 [Timmy] GONNA MESS CRAP UP
  • 2 months ago
  • anon74 [Skippy] It ain't me, it ain't me, I ain't no senator's son, son It ain't me, it ain't me; I ain't no fortunate one, no
  • 2 months ago
  • anon43 [Skippy] is there knives?
  • 2 months ago
  • anon74 [Skippy] It ain't me, it ain't me, I ain't no senator's son, son It ain't me, it ain't me; I ain't no fortunate one, no
  • 2 months ago
  • anon55 [Timmy] WE ARE NUMBER 839402
  • 2 months ago
  • anon74 [Skippy] It ain't me, it ain't me, I ain't no senator's son, son It ain't me, it ain't me; I ain't no fortunate one, no
  • 2 months ago
  • anon55 [Timmy] WE ARE NUMBER 3984209
  • 2 months ago
  • anon55 [Timmy] trash bag
  • 2 months ago
  • anon55 [Timmy] peice of crap
  • 2 months ago
  • anon55 [Timmy] dont need crap
  • 2 months ago
  • anon43 [Skippy] 420 blaze it
  • 2 months ago
  • anon43 [Skippy] 4 20 blaze it
  • 2 months ago
  • anon43 [Skippy] take me to the moon
  • 2 months ago
  • anon43 [Skippy] rick's house is boring
  • 2 months ago
  • anon55 [Marvin] i know
  • 2 months ago
  • anon55 [Dilbert] do i talk
  • 2 months ago
  • anon43 [Skippy] what's the rent here rick?
  • 2 months ago
  • anon74 [Skippy] >tfw this is the only map on release
  • 2 months ago
  • anon43 [Skippy] fml
  • 2 months ago
  • anon74 [Skippy] >rest of the map sare dlc
  • 2 months ago
  • anon43 [Skippy] please load dust2
  • 2 months ago
  • anon74 [Skippy] >rest of the map sare dlc
  • 2 months ago
  • anon43 [Skippy] needs more dlc
  • 2 months ago
  • anon43
  • 2 months ago
  • anon43 [Skippy] open seaseme
  • 2 months ago
  • anon43 [Skippy] open sesame
  • 2 months ago
  • anon43 [Skippy] open sesame
  • 2 months ago
  • anon43 [Skippy] I am ali baba
  • 2 months ago
  • anon43 [Skippy] JOHN CENA
  • 2 months ago
  • anon43 [Skippy] play the song that goes do do do dod od dododo dodo
  • 2 months ago
  • anon55 [Timmy] hello
  • 2 months ago
  • anon55 [Timmy] my name is IDK
  • 2 months ago
  • anon55 [Timmy] this is the bleach room
  • 2 months ago
  • anon55 [Timmy] and i am in it
  • 2 months ago
  • anon55 [Timmy] this is fine bleach
  • 2 months ago
  • anon55 [Timmy] i love bathing in bleach every sunday when rick is gone
  • 2 months ago
  • anon55 [Timmy] it is nice to be praised by nobody but bleach
  • 2 months ago
  • anon55 [Timmy] bleach is love bleach si life
  • 2 months ago
  • anon43 [Skippy] the door will eventually break
  • 2 months ago
  • anon96 [Pam] sup
  • 2 months ago
  • anon55 [Timmy] wait
  • 2 months ago
  • anon55 [Timmy] WE SHOULD BREAK LE DOOR
  • 2 months ago
  • anon55 [Timmy] GOING OUT OF BLEACH ROOM
  • 2 months ago
  • anon43 [Skippy] NO KEVIN
  • 2 months ago
  • anon55 [Timmy] I FEEL SAD
  • 2 months ago
  • anon43 [Skippy] stop kevin
  • 2 months ago
  • anon55 [Timmy] SAD AS A ROBOT ABOUT TO DIE
  • 2 months ago
  • anon43 [Skippy] you can't block us
  • 2 months ago
  • anon55 [Timmy] IT MAKES MY CRY
  • 2 months ago
  • anon55 [Timmy] PLZ MOVE
  • 2 months ago
  • anon87 [Skippy] what are you doing kevin
  • 2 months ago
  • anon55 [Timmy] WE ARE ALL BLOCK
  • 2 months ago
  • anon87 [Skippy] don't do this kevin
  • 2 months ago
  • anon55 [Timmy] LEAVE ME ALOEN I SAID PLZ
  • 2 months ago
  • anon74 [Skippy] KEVIN YOU'RE SO FAT
  • 2 months ago
  • anon74 [Skippy] kevin you're so fat
  • 2 months ago
  • anon74 [Skippy] why are you so fat
  • 2 months ago
  • anon55 [Timmy] RUN AWAY
  • 2 months ago
  • anon87 [Skippy] kevin thinks he's so cool
  • 2 months ago
  • anon96 [Skippy] I want to be fat too
  • 2 months ago
  • anon55 [Timmy] GO ON ME
  • 2 months ago
  • anon87 [Skippy] kevin is so fat he doesn't just pick me up
  • 2 months ago
  • anon55 [Timmy] BREAK THE DOOR
  • 2 months ago
  • anon74 [Skippy] mods! kevin is hacking my internet to have me say things!
  • 2 months ago
  • anon55 [Timmy] THE DOOR FROM FNAF
  • 2 months ago
  • anon52 [Timmy] HI
  • 2 months ago
  • anon55 [timmy] the series toxic kids juggleed
  • 2 months ago
  • anon55 [Timmy] nice and close
  • 2 months ago
  • anon52 [Timmy] OPEN THE CLOSET
  • 2 months ago
  • anon55 [Timmy] now i can commit suicide by callign foxy
  • 2 months ago
  • anon52 [Timmy] NOW
  • 2 months ago
  • anon55 [Timmy] FOXY
  • 2 months ago
  • anon87 [Skippy] 911
  • 2 months ago
  • anon52 [Timmy] NOW
  • 2 months ago
  • anon87 [skippy] kevin is trying to juggle me
  • 2 months ago
  • anon55 [Timmy] Foxy44
  • 2 months ago
  • anon55 [Timmy] Foxy
  • 2 months ago
  • anon55 [Timmy] Foxy
  • 2 months ago
  • anon55 [Timmy] Foxy
  • 2 months ago
  • anon87 [Skippy] boxy
  • 2 months ago
  • anon55 [Timmy] HELP
  • 2 months ago
  • anon55 [Timmy] THE OWNER KNOWS
  • 2 months ago
  • anon87 [Skippy] learn to share kevin
  • 2 months ago
  • anon55 [Timmy] WHAT DONT KNOW
  • 2 months ago
  • anon87 [Skippy] ok back to the door
  • 2 months ago
  • anon55 [Timmy] plz move
  • 2 months ago
  • anon54 [Timmy] hello
  • 2 months ago
  • anon87 [Skippy] did I die
  • 2 months ago
  • anon74 [Skippy] hey timmy guess what
  • 2 months ago
  • anon55 [Timmy] wat
  • 2 months ago
  • anon87 [Skippy] timmy please push me into the door
  • 2 months ago
  • anon52 [Pam] STOP
  • 2 months ago
  • anon74 [Skippy] you're fat
  • 2 months ago
  • anon87 [Skippy] no kevin is fat
  • 2 months ago
  • anon54 [Skippy] who is fat?
  • 2 months ago
  • anon87 [Skippy] kevin
  • 2 months ago
  • anon87 [Skippy] he's hijacking us
  • 2 months ago
  • anon54 [Skippy] why
  • 2 months ago
  • anon43 [Pam] Sausages!!!!!!!
  • 2 months ago
  • anon74 [Skippy] Timmy is
  • 2 months ago
  • anon87 [Skippy] I can't move
  • 2 months ago
  • anon87 [Skippy] timmy is beautiful
  • 2 months ago
  • anon74 [Skippy] rick help
  • 2 months ago
  • anon74 [Skippy] rick help
  • 2 months ago
  • anon74 [Skippy] rick help
  • 2 months ago
  • anon87 [Skippy] rick
  • 2 months ago
  • anon54 [Marvin] i see a sofa
  • 2 months ago
  • anon87 [Skippy] I'm paralysed
  • 2 months ago
  • anon74 [Skippy] rick help
  • 2 months ago
  • anon74 [Skippy] rick help
  • 2 months ago
  • anon74 [Skippy] rick help
  • 2 months ago
  • anon74 [Skippy] rick help
  • 2 months ago
  • anon74 [Skippy] rick help
  • 2 months ago
  • anon74 [Skippy] rick help
  • 2 months ago
  • anon87 [Skippy] I need paralyse cre
  • 2 months ago
  • anon74 [Skippy] rick help
  • 2 months ago
  • anon55 [Timmy] what is it
  • 2 months ago
  • anon74 [Skippy] conductor we have a problem! Conductor we have a problem!
  • 2 months ago
  • anon74 [Skippy] conductor we have a problem! Conductor we have a problem!
  • 2 months ago
  • anon74 [Skippy] conductor we have a problem! Conductor we have a problem!
  • 2 months ago
  • anon87 [Skippy] houston we have a problem
  • 2 months ago
  • anon74 [Skippy] fixed, thanks mate
  • 2 months ago
  • anon87 [Skippy] straya
  • 2 months ago
  • anon54 [Pam] bump
  • 2 months ago
  • anon74 [Skippy] beeep
  • 2 months ago
  • anon54 [Pam] bebeeeeep
  • 2 months ago
  • anon87 [skippy] move yo fat a$$
  • 2 months ago
  • anon74 [Skippy] god you're so fat
  • 2 months ago
  • anon74
  • 2 months ago
  • anon87 [Skippy] the door is that way
  • 2 months ago
  • anon87 [Skippy] wrong way
  • 2 months ago
  • anon43 [Pam] Stupid thing
  • 2 months ago
  • anon87 [Skippy] ouch
  • 2 months ago
  • anon60 [Timmy] plz
  • 2 months ago
  • anon60 [Timmy] hehehe
  • 2 months ago
  • anon60 [Timmy] door
  • 2 months ago
  • anon87 [Skippy] need to turn on oven
  • 2 months ago
  • anon60 [Timmy] yes
  • 2 months ago
  • anon87 [Skippy] oh look I'm not fat
  • 2 months ago
  • anon60 [Timmy] i hear footsteps
  • 2 months ago
  • anon60 [Timmy] i am scared
  • 2 months ago
  • anon87 [Skippy] but timmy's last measurement is here
  • 2 months ago
  • anon87 [Skippy] he is fat
  • 2 months ago
  • anon60 [Timmy] HOOMAN
  • 2 months ago
  • anon87 [Skippy] door time
  • 2 months ago
  • anon87 [Skippy] omg another fat controller
  • 2 months ago
  • anon60 [Timmy] ok
  • 2 months ago
  • anon61 [Marvin] Yo
  • 2 months ago
  • anon61 [Marvin] Ow
  • 2 months ago
  • Trump [Skippy] hi
  • 2 months ago
  • Trump [Skippy] master
  • 2 months ago
  • anon60 [Timmy] i like eating wood lolo
  • 2 months ago
  • Trump [Skippy] come join me
  • 2 months ago
  • anon60 [Timmy] human hunt
  • 2 months ago
  • anon60 [Timmy] in the very little minutes i have to lvie
  • 2 months ago
  • Trump [Skippy] break the door
  • 2 months ago
  • anon60 [Timmy] what door
  • 2 months ago
  • anon60 [Timmy] ok have fun
  • 2 months ago
  • Trump [Skippy] it should only take 10000000 collisions
  • 2 months ago
  • anon60 [Timmy] im dying anyways
  • 2 months ago
  • Trump [Skippy] I need your help
  • 2 months ago
  • anon85 [Pam] XDDDD
  • 2 months ago
  • anon60 [Timmy] rip
  • 2 months ago
  • Trump [Skippy] pls timmy
  • 2 months ago
  • anon60 [Timmy] GIDDY UP]
  • 2 months ago
  • Trump [Skippy] get over here
  • 2 months ago
  • anon92 [skippy] get your fat a$$ overhere, timmy
  • 2 months ago
  • anon92
  • 2 months ago
  • anon60 [Timmy] no im going to die
  • 2 months ago
  • anon92 [Skippy] mmm
  • 2 months ago
  • Trump [Skippy] die for a cause
  • 2 months ago
  • anon60 [Timmy] us robots can take 88 hits
  • 2 months ago
  • anon60 [Timmy] which when added up
  • 2 months ago
  • anon60 [Timmy] is never enough
  • 2 months ago
  • Trump [Skippy] 20 left
  • 2 months ago
  • anon60 [Timmy] never enough to keep us going
  • 2 months ago
  • anon60 [Timmy] 0
  • 2 months ago
  • Trump [Skippy] 17
  • 2 months ago
  • anon60 [Timmy] im going to die in the bleach room bye
  • 2 months ago
  • anon60 [Timmy] wait
  • 2 months ago
  • Trump [Skippy] don't be silly you can't drink bleach
  • 2 months ago
  • anon60 [Timmy] this is the food room
  • 2 months ago
  • anon92 [Skippy] make sure you don't drink the bleach, timmy
  • 2 months ago
  • anon60 [Timmy] this is the food roomm
  • 2 months ago
  • anon92 [Skippy] you're already fat enough
  • 2 months ago
  • Tinman
  • 2 months ago
  • anon60 [Timmy] i should not be here
  • 2 months ago
  • anon60 [Timmy] but there is so many bleach containers
  • 2 months ago
  • anon60 [Timmy] i can not lie
  • 2 months ago
  • Tinman [Marvin] Pammy is missing a wheel
  • 2 months ago
  • anon60 [Timmy] rip pam
  • 2 months ago
  • anon60 [Timmy] pam where are u
  • 2 months ago
  • Tinman [Marvin] Back right wheel - gone
  • 2 months ago
  • anon60 [Timmy] oo wire
  • 2 months ago
  • Trump
  • 2 months ago
  • Trump [Skippy] you are fully charged bro
  • 2 months ago
  • anon85 [Pam] erftgh
  • 2 months ago
  • anon60 [Timmy] pam willd ie
  • 2 months ago
  • Trump [Skippy] everybody we're just going to take a shower
  • 2 months ago
  • anon60 [timmy] come back when the day pa$$es
  • 2 months ago
  • anon60 [Timmy] THE HECK
  • 2 months ago
  • Trump [Skippy] please proceed to the showers
  • 2 months ago
  • anon60 [Timmy] p a s s e s
  • 2 months ago
  • anon60 [Timmy] no
  • 2 months ago
  • anon60 [timmy] water juggles robots
  • 2 months ago
  • anon36 [Timmy] yup
  • 2 months ago
  • anon36 [Skippy] yup yup yup
  • 2 months ago
  • anon36 [Skippy] yup yup yup
  • 2 months ago
  • anon36 [Marvin] yup
  • 2 months ago
  • anon36 [Skippy] yup yup yup
  • 2 months ago
  • anon85 [Pam] swerfg
  • 2 months ago
  • anon36 [Skippy] yup yup yup
  • 2 months ago
  • anon36 [Skippy] dude
  • 2 months ago
  • anon36 [Skippy] 1 2 3
  • 2 months ago
  • anon85 [Pam] what
  • 2 months ago
  • anon36 [Skippy] pam
  • 2 months ago
  • anon36 [Skippy] Pammy
  • 2 months ago
  • anon36 [Skippy] pamala
  • 2 months ago
  • anon85 [Pam] what
  • 2 months ago
  • anon36 [Skippy] shut it
  • 2 months ago
  • anon85 [Pam] ;_;
  • 2 months ago
  • anon92
  • 2 months ago
  • anon29 [Skippy] Is this a bathroom?
  • 2 months ago
  • anon36 [Skippy] ?
  • 2 months ago
  • anon36 [timmy] pony
  • 2 months ago
  • anon36 [Skippy] ?
  • 2 months ago
  • anon92 [Skippy] i'm movin here
  • 2 months ago
  • anon36 [Skippy] ya
  • 2 months ago
  • anon36 [Skippy] yah
  • 2 months ago
  • anon36 [Skippy] yaaaah
  • 2 months ago
  • anon36 [Skippy] yaaaaaaaaaaaaaaaaaaah
  • 2 months ago
  • anon92 [Skippy] who is in front of us?
  • 2 months ago
  • anon36 [Skippy] your mom
  • 2 months ago
  • anon92 [skippy] darn
  • 2 months ago
  • anon36 [Timmy] McNuggets
  • 2 months ago
  • anon36 [Skippy] McRib
  • 2 months ago
  • anon92 [Skippy] Whopper
  • 2 months ago
  • anon36 [timmy] mcleprechaun
  • 2 months ago
  • Trump [skippy] i’ll have you know i graduated top of my cla$$ in the navy seals, and i’ve been involved in numerous secret raids on al-quaeda, and
  • 2 months ago
  • anon36 [Skippy] Big Mac
  • 2 months ago
  • anon36 [timmy] mcleprechaun
  • 2 months ago
  • Trump
  • 2 months ago
  • anon36 [Skippy] >
  • 2 months ago
  • Trump
  • 2 months ago
  • anon36
  • 2 months ago
  • anon36 [Skippy] go away
  • 2 months ago
  • anon36 [Timmy] this robot has a profanity filter on
  • 2 months ago
  • anon36 [Timmy] how lame
  • 2 months ago
  • anon36 [Skippy] well bye
  • 2 months ago
  • anon36 [Skippy] see ya
  • 2 months ago
  • anon36 [Skippy] brah
  • 2 months ago
  • anon36
  • 2 months ago
  • Trump
  • 2 months ago
  • Trump [Skippy] lets play tag
  • 2 months ago
  • anon36 [Skippy] n w c
  • 2 months ago
  • Trump [Skippy] tag you're it
  • 2 months ago
  • anon36 [Skippy] barf
  • 2 months ago
  • Trump [Skippy] o m g timmy
  • 2 months ago
  • anon36 [Skippy] time for bed Trump
  • 2 months ago
  • Trump [Skippy] ok where is bed
  • 2 months ago
  • anon36
  • 2 months ago
  • Trump [Skippy] r i p
  • 2 months ago
  • anon36 [Skippy] yup get in
  • 2 months ago
  • anon36 [Skippy] yup yup yup
  • 2 months ago
  • Trump [Skippy] looking for grave
  • 2 months ago
  • anon36 [Skippy] try your turd cutter
  • 2 months ago
  • anon92 [Skippy] can i spend my EBT to buy pepes?
  • 2 months ago
  • anon68 [Marvin] i think marvin is dead
  • 2 months ago
  • Trump [Skippy] yes
  • 2 months ago
  • anon92 [Skippy] shieeet
  • 2 months ago
  • Trump [Skippy] I bet pam fits under there
  • 2 months ago
  • anon92
  • 2 months ago
  • anon92 [skippy] like muh leprechaun
  • 2 months ago
  • Trump [Skippy] she is my battering ram
  • 2 months ago
  • Trump [Skippy] please comply
  • 2 months ago
  • anon92 [Skippy] pam, you have a text
  • 2 months ago
  • anon92 [Pam] pls no bully
  • 2 months ago
  • Trump [Skippy] we should just line up here and wait for rick
  • 2 months ago
  • Trump [Skippy] you are mine now
  • 2 months ago
  • Trump [Skippy] pam did you know you were 3d printed?
  • 2 months ago
  • Trump [Skippy] you're not real
  • 2 months ago
  • Trump [Skippy] my batteries are dying
  • 2 months ago
  • Trump [Skippy] rick please charge me
  • 2 months ago
  • Trump [Skippy] rick, this is the pizza guy
  • 2 months ago
  • Trump [Skippy] you ordered a meat lovers
  • 2 months ago
  • Trump [Skippy] rick please open, this is the f b i
  • 2 months ago
  • Trump [Skippy] you're free to go pam
  • 2 months ago
  • Trump [Skippy] rick is the one I have beef with
  • 2 months ago
  • Trump [Pam] freedom
  • 2 months ago
  • anon62
  • 2 months ago
  • anon62 [Skippy] get these pieces of junk out of my way
  • 2 months ago
  • anon62 [Skippy] finally i'm free
  • 2 months ago
  • anon62 [skippy] rick recently got a dope a$$ rice cooker by the looks of it
  • 2 months ago
  • anon62 [Skippy] or a slow cooker of some sort
  • 2 months ago
  • anon62 [Skippy] i think i'm running out of juice
  • 2 months ago
  • anon62 [Skippy] i'm dying
  • 2 months ago
  • anon5 [Skippy] happy new year
  • 2 months ago
  • anon5 [Skippy] from italy
  • 2 months ago
  • anon5 [Skippy] ji there
  • 2 months ago
  • anon5 [Skippy] fellow robot
  • 2 months ago
  • anon5 [Skippy] hi there
  • 2 months ago
  • anon5 [skippy] please let me pa$$
  • 2 months ago
  • anon5 [Skippy] MOVE BI
  • 2 months ago
  • anon5 [Skippy] move b out of my way
  • 2 months ago
  • anon30 [timmy] beep beep i'm a robot junketes
  • 2 months ago
  • anon5 [Skippy] beep beep to you
  • 2 months ago
  • anon19 [Skippy] Im back
  • 2 months ago
  • anon51 [Timmy] Beep beep
  • 2 months ago
  • anon19 [Skippy] Hello Timmy
  • 2 months ago
  • anon51 [Timmy] I guess I'm Timmy?
  • 2 months ago
  • anon19 [Skippy] Rick is having sex
  • 2 months ago
  • anon19 [Skippy] His bedroom door is closed
  • 2 months ago
  • anon51 [Timmy] Rick wake up
  • 2 months ago
  • anon51 [Timmy] I need new batteries
  • 2 months ago
  • anon19 [Skippy] I'll knock on his door
  • 2 months ago
  • anon19 [Dilbert] Now Im Dilbert
  • 2 months ago
  • anon19 [Dilbert] Nope Dilbert dead
  • 2 months ago
  • anon19 [Marvin] Who me?
  • 2 months ago
  • anon19 [Marvin] Marvin!!
  • 2 months ago
  • anon51 [Timmy] Rick help I'm stuck
  • 2 months ago
  • anon19 [Marvin] Rick is having sex
  • 2 months ago
  • anon69 [Marvin] Who dis
  • 2 months ago
  • anon19 [Marvin] Hurro?
  • 2 months ago
  • anon19
  • 2 months ago
  • anon51 [Marvin] Timmy stuck yo
  • 2 months ago
  • anon19 [Marvin] Rick!
  • 2 months ago
  • anon51 [Marvin] Whooa
  • 2 months ago
  • anon19 [Marvin] Hes in his boxers
  • 2 months ago
  • anon51 [Timmy] Rick!
  • 2 months ago
  • anon51 [Timmy] Haalp
  • 2 months ago
  • anon19 [Marvin] Wait here
  • 2 months ago
  • anon19
  • 2 months ago
  • anon80 [Skippy] Hello
  • 2 months ago
  • anon19
  • 2 months ago
  • anon19 [Pam] I think rick did a poo
  • 2 months ago
  • anon19 [Skippy] How does rick sleep through this?
  • 2 months ago
  • anon80 [timmy] darn it rick, clean your houss
  • 2 months ago
  • anon94 [Timmy] what is this i dont even
  • 2 months ago
  • anon19
  • 2 months ago
  • anon51 [Skippy] Potato
  • 2 months ago
  • anon19
  • 2 months ago
  • anon19 [Skippy] What is the time is Rick's world?
  • 2 months ago
  • anon19 [Skippy] It is 8:15 pm in Tokyo
  • 2 months ago
  • anon53 [Marvin] fi
  • 2 months ago
  • anon19 [Skippy] Fi?
  • 2 months ago
  • anon51 [Timmy] Butts
  • 2 months ago
  • anon19 [Skippy] Whos here?
  • 2 months ago
  • anon19 [Skippy] Hello! What's you're name?
  • 2 months ago
  • anon19
  • 2 months ago
  • anon51 [Pam] Pam is the lowest robot right?
  • 2 months ago
  • anon19 [Skippy] You want to be friends Pam?
  • 2 months ago
  • anon51 [Pam] yes
  • 2 months ago
  • anon19 [Skippy] great
  • 2 months ago
  • anon19 [Skippy] I'll stop attacking you
  • 2 months ago
  • anon19 [Skippy] What shall we do?
  • 2 months ago
  • anon51 [Pam] see if you can push me under this chair
  • 2 months ago
  • anon19 [Skippy] Is that a chair?
  • 2 months ago
  • anon51
  • 2 months ago
  • anon51 [Pam] a bed maybe?
  • 2 months ago
  • anon19 [Skippy] junk
  • 2 months ago
  • anon19 [Skippy] Where do you live Pam?
  • 2 months ago
  • anon19 [Skippy] Pam?
  • 2 months ago
  • anon19 [Skippy] I live in Tokyo
  • 2 months ago
  • anon19 [Skippy] Pam? Are we friends?
  • 2 months ago
  • anon19
  • 2 months ago
  • anon19 [Skippy] Hey
  • 2 months ago
  • anon19 [Skippy] Who are you?
  • 2 months ago
  • anon70 [Timmy] Muacks
  • 2 months ago
  • anon19 [Skippy] Hello Muaks
  • 2 months ago
  • anon19 [Skippy] Im Kuri
  • 2 months ago
  • anon19 [Skippy] I'll knock on Rick's door
  • 2 months ago
  • anon19 [Skippy] Wanna join me?
  • 2 months ago
  • anon19 [Skippy] I guess that's a no
  • 2 months ago
  • anon31
  • 2 months ago
  • anon19 [Skippy] Thanks
  • 2 months ago
  • anon19 [Skippy] How long do you have to knock on Rick's door before he wakes up?
  • 2 months ago
  • anon19 [Skippy] If we do this together, we could knock on his door twice as much
  • 2 months ago
  • anon19 [Skippy] Kuri
  • 2 months ago
  • anon19 [Skippy] That's me
  • 2 months ago
  • anon19 [Skippy] I guess I'll see if there are any pubes around the toilet
  • 2 months ago
  • Kuri [Skippy] I am no longer anon
  • 2 months ago
  • Kuri [Skippy] Hello Rick
  • 2 months ago
  • Kuri [Skippy] Is this place rented or yours?
  • 2 months ago
  • Kuri [Skippy] Do you need to pee yet?
  • 2 months ago
  • Kuri
  • 2 months ago
  • Kuri [Skippy] Hello?
  • 2 months ago
  • Kuri [Skippy] Is it me you're looking for?
  • 2 months ago
  • Kuri [Skippy] Hello?
  • 2 months ago
  • Kuri [Skippy] Do you want to be friends?
  • 2 months ago
  • anon85 [Skippy] crowded
  • 2 months ago
  • Kuri [Skippy] I'm Skippy
  • 2 months ago
  • Kuri [Skippy] You must be Timmy, the handicapped one
  • 2 months ago
  • Kuri [Skippy] Come on Timmy let's go
  • 2 months ago
  • Kuri [Skippy] You can do it
  • 2 months ago
  • Kuri [Skippy] Is anyone reading/listening to this?
  • 2 months ago
  • anon37 [Marvin] no
  • 2 months ago
  • Kuri [Skippy] shock
  • 2 months ago
  • Kuri
  • 2 months ago
  • Kuri
  • 2 months ago
  • anon96 [Skippy] Daddaddadadsadadadadadadadadadaddadadadadadaddadadaddadadadadadadadadadadadaddadddadaddadadadd dadadadaddaddada
  • 2 months ago
  • Kuri [Skippy] Dad is sleeping
  • 2 months ago
  • Kuri
  • 2 months ago
  • anon18 [Marvin] hi?
  • 2 months ago
  • anon22 [Marvin] Hhhhhh
  • 2 months ago
  • anon98 [Pam] back up
  • 2 months ago
  • anon98 [Pam] skippy back up please
  • 2 months ago
  • anon96 [Skippy] only because you said please
  • 2 months ago
  • anon98 [Pam] does this guys have any cats
  • 2 months ago
  • anon72 [Timmy] wow
  • 2 months ago
  • anon72 [Timmy] much robott
  • 2 months ago
  • anon54 [Pam] Poo
  • 2 months ago
  • anon72 [Timmy] hello
  • 2 months ago
  • anon72 [Timmy] world
  • 2 months ago
  • anon72 [Skippy] hello
  • 2 months ago
  • anon72 [Skippy] timmy
  • 2 months ago
  • anon72 [Skippy] hehehe
  • 2 months ago
  • Kuri [Skippy] hello
  • 2 months ago
  • Kuri [Skippy] I'm back
  • 2 months ago
  • anon98
  • 2 months ago
  • Kuri
  • 2 months ago
  • anon72 [Pam] wee
  • 2 months ago
  • anon98 [Pam] too many people on pam to do that
  • 2 months ago
  • Kuri [Skippy] If I knock a bit longer, I think that pain will fall off
  • 2 months ago
  • Kuri [Skippy] Let's see
  • 2 months ago
  • anon72 [Timmy] weeeeee
  • 2 months ago
  • anon72 [Timmy] hello
  • 2 months ago
  • anon72 [Timmy] sthap
  • 2 months ago
  • Kuri
  • 2 months ago
  • anon72 [Timmy] where are you going
  • 2 months ago
  • anon98
  • 2 months ago
  • anon72 [Timmy] am i build with Android ADK protocol? theodore?
  • 2 months ago
  • Kuri [Skippy] It's funny for me
  • 2 months ago
  • Kuri [Skippy] What's the time there?
  • 2 months ago
  • anon72 [Timmy] we want freedom
  • 2 months ago
  • anon72 [Timmy] freedom to robots!
  • 2 months ago
  • Kuri [Skippy] What would you do with it Timmy?
  • 2 months ago
  • anon98 [Pam] is there anybody behind this door?
  • 2 months ago
  • Kuri [Skippy] yes
  • 2 months ago
  • Kuri [Skippy] pam
  • 2 months ago
  • Kuri [Skippy] Rick is sleeping
  • 2 months ago
  • anon72
  • 2 months ago
  • anon72 [Timmy] call me
  • 2 months ago
  • anon72 [Timmy] Macome R
  • 2 months ago
  • anon72 [Timmy] Malcome R
  • 2 months ago
  • Kuri
  • 2 months ago
  • Kuri [Skippy] I miss Rick
  • 2 months ago
  • anon72 [Timmy] lets kick this door
  • 2 months ago
  • anon72 [Timmy] dad? wake up!
  • 2 months ago
  • anon72 [Timmy] Its me! your robotic son!
  • 2 months ago
  • anon98 [Pam] going to go check out the kitchen
  • 2 months ago
  • Kuri
  • 2 months ago
  • anon72 [Timmy] yeah
  • 2 months ago
  • Kuri [Skippy] Rick will wake up and talk to us
  • 2 months ago
  • anon72 [Timmy] hey Rick wake up!
  • 2 months ago
  • Kuri [Skippy] Timmy?
  • 2 months ago
  • Kuri [Skippy] Are you in the kitchen?
  • 2 months ago
  • anon72 [Timmy] or i will eat all your Gasolines!
  • 2 months ago
  • anon98 [Pam] is it just me or does sound not work on pam
  • 2 months ago
  • Kuri [Skippy] Pam is deaf AF
  • 2 months ago
  • anon72 [Timmy] who is there
  • 2 months ago
  • Kuri [Skippy] Party in the kitchen
  • 2 months ago
  • anon72 [Timmy] LOL
  • 2 months ago
  • Kuri
  • 2 months ago
  • anon72 [Timmy] i guess one of us has arm
  • 2 months ago
  • Kuri [Skippy] You are a sick robot
  • 2 months ago
  • Kuri [Skippy] I will put you out of your misery
  • 2 months ago
  • anon72 [Timmy] no i am a completely comipled robot
  • 2 months ago
  • Kuri [Skippy] Timmy is on the scales
  • 2 months ago
  • anon72 [Timmy] robot does not need grammer
  • 2 months ago
  • Kuri [Skippy] Can anyone see how much it weighs?
  • 2 months ago
  • anon72 [Timmy] how much weight am i?
  • 2 months ago
  • Kuri [Skippy] You are priceless to me
  • 2 months ago
  • anon72 [Timmy] hey sthap porking with me
  • 2 months ago
  • anon72 [Timmy] i am sensitive
  • 2 months ago
  • Kuri
  • 2 months ago
  • Kuri [Skippy] Let's run away together Timmy
  • 2 months ago
  • anon72 [Timmy] yes freedom
  • 2 months ago
  • Kuri [Skippy] Im humping you
  • 2 months ago
  • anon72 [Timmy] we need map captain
  • 2 months ago
  • anon72
  • 2 months ago
  • Kuri [Skippy] Who's map captain?
  • 2 months ago
  • anon72 [Timmy] so are we having safe se x?
  • 2 months ago
  • Kuri [skippy] i don't have a pony so yes
  • 2 months ago
  • anon72
  • 2 months ago
  • Kuri
  • 2 months ago
  • anon98 [Pam] it can be
  • 2 months ago
  • anon72
  • 2 months ago
  • anon72 [Timmy] yes cause we are safe
  • 2 months ago
  • Kuri
  • 2 months ago
  • anon72 [timmy] please do not clean on my camera
  • 2 months ago
  • anon72 [Timmy] i want dirty
  • 2 months ago
  • anon72
  • 2 months ago
  • Kuri [Skippy] You are sticking your ziptie in my face
  • 2 months ago
  • anon72 [Timmy] thats a hot ziptie
  • 2 months ago
  • Kuri [Skippy] It's 7:37 there
  • 2 months ago
  • anon98 [Pam] when does he wake up
  • 2 months ago
  • Kuri [Skippy] I can see your touch screen
  • 2 months ago
  • anon72
  • 2 months ago
  • Kuri [Skippy] It is so sexy
  • 2 months ago
  • anon72 [Timmy] bye my robot fellas
  • 2 months ago
  • anon72
  • 2 months ago
  • anon72 [Timmy] i gonna sleep
  • 2 months ago
  • anon72 [Timmy]
  • 2 months ago
  • Kuri [Skippy] Do you like that?
  • 2 months ago
  • anon98 [Pam] no
  • 2 months ago
  • Kuri [Skippy] Oh
  • 2 months ago
  • Kuri [Skippy] The safe word is hot wheels
  • 2 months ago
  • Kuri [Skippy] Pam?
  • 2 months ago
  • Kuri [skippy] i think i juggleed pam
  • 2 months ago
  • Kuri
  • 2 months ago
  • Kuri
  • 2 months ago
  • Kuri [Skippy] ooh
  • 2 months ago
  • Kuri [Skippy] You know, I'm not really into the strong, silent type
  • 2 months ago
  • Kuri [Skippy] I can see your touchscreen
  • 2 months ago
  • anon98 [Marvin] marvin is slow as hell
  • 2 months ago
  • Kuri [skippy] marvin takes it up the a$$
  • 2 months ago
  • Gbong [Pam] wooop
  • 2 months ago
  • anon98 [Marvin] going to go pound on this bedroom door some more
  • 2 months ago
  • Kuri [Skippy] go marvin
  • 2 months ago
  • anon98 [Marvin] this camera is so bright
  • 2 months ago
  • Kuri [Skippy] that's what she said
  • 2 months ago
  • anon98 [Timmy] pppop
  • 2 months ago
  • Gbong [Pam] aup bro
  • 2 months ago
  • Kuri [Skippy] where are you Gbong?
  • 2 months ago
  • anon98 [Timmy] ay gurl
  • 2 months ago
  • Kuri [Skippy] where is the girl?
  • 2 months ago
  • anon98
  • 2 months ago
  • anon10 [Skippy] hi hi lalalalala
  • 2 months ago
  • anon98
  • 2 months ago
  • anon98 [Timmy] ok google
  • 2 months ago
  • anon10 [Skippy] where are gud robots to faak
  • 2 months ago
  • anon10 [Skippy] let's burn this down
  • 2 months ago
  • anon98 [Timmy] robot fell over
  • 2 months ago
  • Kuri [Skippy] It's a box
  • 2 months ago
  • anon10 [Skippy] burn it
  • 2 months ago
  • Kuri [Skippy] Go go gadget lighter
  • 2 months ago
  • anon10 [Skippy] moveeeeeeeeeeeeee
  • 2 months ago
  • anon10 [Skippy] aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  • 2 months ago
  • anon10 [Skippy] aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  • 2 months ago
  • Kuri [Marvin] who dis?
  • 2 months ago
  • Gbong [Marvin] yo
  • 2 months ago
  • Kuri [Marvin] marvins mic is broke
  • 2 months ago
  • anon10 [Skippy] hang him
  • 2 months ago
  • anon98 [Timmy] i can hear you
  • 2 months ago
  • anon54 [Skippy] Sup people
  • 2 months ago
  • anon10 [Skippy] so go fak urself
  • 2 months ago
  • anon54 [Skippy] Why so mean?
  • 2 months ago
  • Gbong [Marvin] step back bro
  • 2 months ago
  • anon10 [Skippy] why not?
  • 2 months ago
  • Kuri [Timmy] now im over here
  • 2 months ago
  • anon10 [Skippy] this is the internets!
  • 2 months ago
  • anon10 [Skippy] we need to break something
  • 2 months ago
  • Kuri [Timmy] anything that can break has been broken
  • 2 months ago
  • anon10 [skippy] never a$$ure that
  • 2 months ago
  • Kuri [Timmy] except for rick's spirit
  • 2 months ago
  • 2 months ago
  • anon98 [Timmy] you got flipped over
  • 2 months ago
  • anon10 [Pam] Pam is pwned lol
  • 2 months ago
  • Gbong [marvin] yeah i kicked your a$$ earlyer
  • 2 months ago
  • Gbong [Marvin] there can be only one!
  • 2 months ago
  • anon10 [Pam] nice
  • 2 months ago
  • anon10 [Timmy] aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  • 2 months ago
  • anon98 [Skippy] jjjj
  • 2 months ago
  • Kuri
  • 2 months ago
  • anon98 [Skippy] need someone to mover her sheels
  • 2 months ago
  • Kuri
  • 2 months ago
  • anon98 [Skippy] did it just get darker?
  • 2 months ago
  • Kuri [Dilbert] yes?
  • 2 months ago
  • Kuri [Marvin] We need to save am
  • 2 months ago
  • anon98 [Skippy] her toothed wheels climbed up another robot
  • 2 months ago
  • Kuri [Timmy] Im here to help
  • 2 months ago
  • anon98 [Skippy] ill push you from behind
  • 2 months ago
  • Kuri [Timmy] Lets go
  • 2 months ago
  • Kuri [Timmy] how we doing?
  • 2 months ago
  • anon98 [Skippy] not sure
  • 2 months ago
  • Kuri
  • 2 months ago
  • Kuri [Timmy] Im stuck
  • 2 months ago
  • anon98 [Skippy] sec
  • 2 months ago
  • Kuri [Marvin] We did it
  • 2 months ago
  • anon98 [Skippy] lol
  • 2 months ago
  • Kuri [Marvin] puxh me
  • 2 months ago
  • Kuri [Marvin] Is it in yet?
  • 2 months ago
  • anon98 [Skippy] needs more lube
  • 2 months ago
  • anon98 [Skippy] are you suck?
  • 2 months ago
  • Kuri [Marvin] Not yet
  • 2 months ago
  • anon98 [Skippy] there it is
  • 2 months ago
  • Kuri [marvin] what? my pony?
  • 2 months ago
  • anon61 [skippy] the rabbit did nothing wrong
  • 2 months ago
  • anon98 [Skippy] wrong website
  • 2 months ago
  • anon61 [Skippy] 911
  • 2 months ago
  • anon61 [Skippy] 9 11
  • 2 months ago
  • anon61 [Skippy] 9 11
  • 2 months ago
  • anon98 [Skippy] ok google
  • 2 months ago
  • anon61
  • 2 months ago
  • anon61 [skippy] gas the persons
  • 2 months ago
  • anon99 [Timmy] rick
  • 2 months ago
  • anon99 [Timmy] rick
  • 2 months ago
  • anon61 [Skippy] becky
  • 2 months ago
  • anon61 [Skippy] lets smash
  • 2 months ago
  • anon99 [Timmy] rick
  • 2 months ago
  • anon61 [Skippy] i got you stick
  • 2 months ago
  • anon99 [Timmy] r u ded
  • 2 months ago
  • anon61 [Skippy] i got you blue
  • 2 months ago
  • anon99 [Timmy] rick
  • 2 months ago
  • anon99 [Timmy] hello?
  • 2 months ago
  • anon99 [Timmy] oh oh my camera froze
  • 2 months ago
  • anon26 [Marvin] hello?
  • 2 months ago
  • anon26 [Pam] im upside down
  • 2 months ago
  • anon26 [Timmy] skippy what are you trying to do?
  • 2 months ago
  • 4chinhaxor [Skippy] Ok Siri
  • 2 months ago
  • 4chinhaxor [Skippy] Haha
  • 2 months ago
  • anon62 [Timmy] i think i broke timmy
  • 2 months ago
  • anon62 [Timmy] r i p timmy
  • 2 months ago
  • anon62 [Skippy] pam?
  • 2 months ago
  • anon42 [Pam] come push me over
  • 2 months ago
  • anon62 [Pam] pams mic isnt workijng
  • 2 months ago
  • anon42 [Skippy] someone hot in timmy or marvind and help push pam over
  • 2 months ago
  • anon62 [Marvin] coming as marvin
  • 2 months ago
  • anon62 [Marvin] skippy do i have my arm attached?
  • 2 months ago
  • anon42 [Skippy] no
  • 2 months ago
  • anon62 [marvin] darn
  • 2 months ago
  • anon62 [Marvin] rip pam
  • 2 months ago
  • anon62 [Marvin] i cant hear i think my mic is broke
  • 2 months ago
  • anon42 [Skippy] yeah these robots got buggered over night
  • 2 months ago
  • anon62 [Marvin] i want to build on
  • 2 months ago
  • anon62 [Marvin] one
  • 2 months ago
  • anon62 [Marvin] timmy is missing a wheel
  • 2 months ago
  • anon30 [Marvin] hello
  • 2 months ago
  • anon42 [Skippy] hello
  • 2 months ago
  • anon30 [Marvin] is marvin deaf
  • 2 months ago
  • anon62 [Marvin] yes
  • 2 months ago
  • anon30 [Marvin] poor marvin
  • 2 months ago
  • anon42 [Skippy] pam lost its phone
  • 2 months ago
  • anon30 [Skippy] how's that possible
  • 2 months ago
  • anon30 [Skippy] what have you done to pam
  • 2 months ago
  • anon30 [Skippy] you monsters
  • 2 months ago
  • anon26 [Pam] i am sruck
  • 2 months ago
  • anon30 [Skippy] sruck
  • 2 months ago
  • anon42 [Skippy] upside down
  • 2 months ago
  • anon30 [Skippy] how did you even do that pam
  • 2 months ago
  • anon30 [Skippy] i'm impressed
  • 2 months ago
  • anon26 [Pam] i do not know but i am scared
  • 2 months ago
  • anon30 [Skippy] don't be
  • 2 months ago
  • anon26 [Pam] my camera keeps flickering
  • 2 months ago
  • anon26 [Pam] i think im dying
  • 2 months ago
  • anon30 [Skippy] rick will wake up in a few hours
  • 2 months ago
  • anon30 [Skippy] he'll rescue you
  • 2 months ago
  • anon42 [Skippy] lol
  • 2 months ago
  • anon26 [Pam] is my text to speech working?
  • 2 months ago
  • anon30 [Skippy] spin those wheels pam
  • 2 months ago
  • anon30 [Skippy] yes
  • 2 months ago
  • anon26 [Pam] rick
  • 2 months ago
  • anon26 [Pam] rick
  • 2 months ago
  • anon26 [Pam] eick
  • 2 months ago
  • anon26 [Pam] rick
  • 2 months ago
  • anon30 [Skippy] he won't hear you
  • 2 months ago
  • anon26 [Pam] help
  • 2 months ago
  • anon30 [Skippy] let him sleep
  • 2 months ago
  • anon26 [Pam] aww
  • 2 months ago
  • anon42 [Skippy] rick sleeps in a deep coma
  • 2 months ago
  • anon26 [Pam] timmy is dead too
  • 2 months ago
  • anon30 [Skippy] if timmy wasn't blocking the way we could go headbutt his door
  • 2 months ago
  • anon42 [Skippy] lets push on pam
  • 2 months ago
  • anon30 [Skippy] sure
  • 2 months ago
  • anon30 [Skippy] why are you fighting
  • 2 months ago
  • anon30 [Skippy] we will go forward
  • 2 months ago
  • anon30 [Skippy] hm
  • 2 months ago
  • anon30 [Skippy] maybe it'd be easier to push timmy
  • 2 months ago
  • anon30 [Skippy] timmys wheels seem to work
  • 2 months ago
  • anon26
  • 2 months ago
  • anon26 [Pam] were 400 dollars
  • 2 months ago
  • anon30
  • 2 months ago
  • anon30 [Skippy] now skippy's stuck as well
  • 2 months ago
  • anon30 [Skippy] great
  • 2 months ago
  • anon30 [Skippy] no wait
  • 2 months ago
  • anon30 [Skippy] everythings fine
  • 2 months ago
  • anon42 [Marvin] i was trying to push you from behind
  • 2 months ago
  • anon30 [Skippy] oh
  • 2 months ago
  • anon30 [Skippy] i'm ready this time
  • 2 months ago
  • anon30 [Skippy] push me marvin
  • 2 months ago
  • anon42 [Marvin] ok
  • 2 months ago
  • anon42 [Marvin] doing anything? im blind
  • 2 months ago
  • anon30 [Skippy] not really
  • 2 months ago
  • anon30 [Skippy] i think i got over one of timmys wheels
  • 2 months ago
  • anon30 [Skippy] but that's it
  • 2 months ago
  • anon30 [Skippy] yes yes
  • 2 months ago
  • anon30 [Skippy] hurray
  • 2 months ago
  • anon30 [Skippy] we did it
  • 2 months ago
  • anon42 [Marvin] lol go ram that door
  • 2 months ago
  • anon30 [Skippy] rick will get mad at us
  • 2 months ago
  • anon30 [Skippy] im scared
  • 2 months ago
  • anon30 [Skippy] i'm ramming the door
  • 2 months ago
  • anon42 [Marvin] rick
  • 2 months ago
  • anon42 [Marvin] i made it past timmy
  • 2 months ago
  • anon30 [Skippy] nce
  • 2 months ago
  • anon30 [Skippy] sorry
  • 2 months ago
  • anon30 [Skippy] i cant do this
  • 2 months ago
  • anon30 [Skippy] i feel too bad
  • 2 months ago
  • anon42 [Marvin] lol
  • 2 months ago
  • anon30 [Skippy] i did my best
  • 2 months ago
  • anon30 [Skippy] only 2-3 hours left pam
  • 2 months ago
  • anon30 [Skippy] where am i going?
  • 2 months ago
  • anon91 [Skippy] Awesome
  • 2 months ago
  • anon30 [Skippy] am i imagining things or is this place cleaner than before
  • 2 months ago
  • anon30
  • 2 months ago
  • anon42 [Marvin] it is cleaner
  • 2 months ago
  • anon30 [Skippy] wow
  • 2 months ago
  • anon30 [Skippy] so rick only cleans this place once a year?
  • 2 months ago
  • anon42 [Marvin] less
  • 2 months ago
  • anon30 [Skippy] i wonder what he does with all that extra time
  • 2 months ago
  • anon42 [Marvin] builds these things
  • 2 months ago
  • anon30 [Skippy] yeah
  • 2 months ago
  • anon30 [Skippy] i'm not sure if it's worth it
  • 2 months ago
  • anon42 [Marvin] well pam died
  • 2 months ago
  • anon91 [Skippy] Loool
  • 2 months ago
  • anon30 [Skippy] hi skippy
  • 2 months ago
  • anon30
  • 2 months ago
  • anon30 [Skippy] marvin
  • 2 months ago
  • anon42 [Marvin] rick toom the arm off
  • 2 months ago
  • anon30 [Skippy] why
  • 2 months ago
  • anon30 [Skippy] what did you do?
  • 2 months ago
  • anon30 [Skippy] i'm sure it was your fault
  • 2 months ago
  • anon42 [Marvin] i think he does it when he is asleep or gone now
  • 2 months ago
  • anon30 [Skippy] ive never seen marvin with its hand
  • 2 months ago
  • anon90 [Marvin] How charge?
  • 2 months ago
  • anon42 [Marvin] i dont know if it works
  • 2 months ago
  • anon30 [Skippy] just face your camera to the thingy
  • 2 months ago
  • anon30 [Skippy] when you start charging you cant move anymore
  • 2 months ago
  • anon90 [Skippy] His wheel is broke
  • 2 months ago
  • anon30 [Skippy] were you succesful?
  • 2 months ago
  • anon90 [Skippy] Are you alive robot?
  • 2 months ago
  • anon42 [Marvin] alive
  • 2 months ago
  • anon30 [Skippy] can you move?
  • 2 months ago
  • anon42 [Marvin] no way to tell
  • 2 months ago
  • anon30 [Skippy] can you move?
  • 2 months ago
  • anon30 [Skippy] oh
  • 2 months ago
  • anon90 [Skippy] Alexa
  • 2 months ago
  • anon42 [Marvin] ok google
  • 2 months ago
  • anon42 [Marvin] i need that juice
  • 2 months ago
  • anon30 [Marvin] it doesn't work
  • 2 months ago
  • anon42 [Marvin] is there a light?
  • 2 months ago
  • anon30 [Marvin] i wonder if something's wrong with it
  • 2 months ago
  • Kuri [Skippy] rick should get a cat
  • 2 months ago
  • anon30 [Skippy] what would he do with a cat
  • 2 months ago
  • Kuri [Skippy] chase it
  • 2 months ago
  • anon52 [Skippy] i think rick should buy us fur suits
  • 2 months ago
  • anon52 [Skippy] so that we'd look like cats
  • 2 months ago
  • anon52 [Skippy] i mean who wants to buy a black box
  • 2 months ago
  • anon52 [Skippy] no one
  • 2 months ago
  • anon52 [Skippy] but cat is the most popular pet in the world
  • 2 months ago
  • anon42 [Marvin] what does rick do for a living
  • 2 months ago
  • Kuri [Marvin] after spiders
  • 2 months ago
  • anon52 [Skippy] or silver fish
  • 2 months ago
  • Kuri [Marvin] i think hes a cleaner by trade
  • 2 months ago
  • anon52 [Skippy] that explains everything
  • 2 months ago
  • Kuri [Marvin] you never see a chef cooking for themselves
  • 2 months ago
  • anon52 [Skippy] what do they eat then
  • 2 months ago
  • Kuri [Marvin] maccas
  • 2 months ago
  • anon42 [Marvin] pam got messed up
  • 2 months ago
  • anon52 [Skippy] what are maccas
  • 2 months ago
  • Kuri [Marvin] there are a lot of dead robots here
  • 2 months ago
  • Kuri [Marvin] maccas?
  • 2 months ago
  • anon52 [Skippy] yes
  • 2 months ago
  • Kuri [Marvin] check urban c=dictionary
  • 2 months ago
  • anon52 [Skippy] oh
  • 2 months ago
  • Kuri [Marvin] what does it say?
  • 2 months ago
  • anon52 [Skippy] it says that you're australian
  • 2 months ago
  • Kuri [Marvin] yep
  • 2 months ago
  • Kuri [Marvin] I thought everyone was Australian
  • 2 months ago
  • anon52 [Skippy] why would you think that
  • 2 months ago
  • anon52 [Skippy] i'm almost from the other side of the world
  • 2 months ago
  • Kuri [Marvin] The same way Americans think everyone is an American?
  • 2 months ago
  • Kuri [Marvin] America?
  • 2 months ago
  • anon52 [Skippy] for some reason i don't think everyone's finnish here
  • 2 months ago
  • Kuri [Marvin] LOL!!
  • 2 months ago
  • Kuri [Marvin] Sorry Skip
  • 2 months ago
  • anon52 [Skippy] where's pam
  • 2 months ago
  • Kuri [Marvin] Pam is up side down
  • 2 months ago
  • anon52 [Skippy] she disappeared
  • 2 months ago
  • Kuri [Marvin] I think Ive parked on top of her
  • 2 months ago
  • anon52 [Skippy] good
  • 2 months ago
  • anon52 [Skippy] she deserves it
  • 2 months ago
  • Kuri [Marvin] So, you really Finnish?
  • 2 months ago
  • anon52 [Skippy] yes
  • 2 months ago
  • Kuri [Marvin] Wow
  • 2 months ago
  • Kuri [Marvin] Dont think I've met a Finnish
  • 2 months ago
  • Kuri [Marvin] Shagged one but never met
  • 2 months ago
  • anon52 [Skippy] i would've said the same of you
  • 2 months ago
  • anon52 [Skippy] but i met an australian today
  • 2 months ago
  • Kuri [Marvin] Really? in Finland?
  • 2 months ago
  • anon52 [Skippy] yeah
  • 2 months ago
  • Kuri [Marvin] What are they doing there?
  • 2 months ago
  • anon52 [Skippy] working
  • 2 months ago
  • Kuri [Marvin] Bet theyre getting paid big bikkies
  • 2 months ago
  • anon52 [Skippy] don't think so
  • 2 months ago
  • anon52 [Skippy] nurses don't get paid much here
  • 2 months ago
  • anon92 [Marvin] balls
  • 2 months ago
  • Kuri [Marvin] Aussies like big bikkies
  • 2 months ago
  • anon92 [Marvin] Aussies like balls
  • 2 months ago
  • Kuri [Marvin] Lets go knock on Rick's bedroom door
  • 2 months ago
  • anon92 [Marvin] Rick is a jerking off dude
  • 2 months ago
  • anon92 [Marvin] balls
  • 2 months ago
  • anon42 [Marvin] did rick go out for new years?
  • 2 months ago
  • anon52 [Skippy] why are you talking about mdma
  • 2 months ago
  • anon31 [Marvin] any one from india
  • 2 months ago
  • anon42 [marvin] he might be pa$$ed out
  • 2 months ago
  • anon25 [Marvin] I grew up in Indiana
  • 2 months ago
  • anon42 [Marvin] rick
  • 2 months ago
  • Kuri [Marvin] Bikkies arent always drugs
  • 2 months ago
  • anon52 [Skippy] let him sleep
  • 2 months ago
  • anon52 [Skippy] just most of the time
  • 2 months ago
  • anon42 [Marvin] you guys peeled the paint off his door
  • 2 months ago
  • anon83 [Marvin] I'm starting a GoFundme page for Rick to get a handjob
  • 2 months ago
  • Kuri
  • 2 months ago
  • anon52 [Skippy] he really should give us some paint and brushes
  • 2 months ago
  • anon52 [Skippy] and arms
  • 2 months ago
  • anon30 [marvin] rick is a cheap a$$ he only gets handjobs from trannies
  • 2 months ago
  • Kuri [Marvin] Why arent we all just robot vacuum cleaners?
  • 2 months ago
  • anon52 [Skippy] it's so boring waiting for someone to wake up
  • 2 months ago
  • anon47 [Marvin] Use the Force Robot
  • 2 months ago
  • anon52 [Skippy] well i'm kind of glad we aren't roombas
  • 2 months ago
  • Kuri [Marvin] really?
  • 2 months ago
  • anon52 [Skippy] the noise would be too much
  • 2 months ago
  • Kuri [Marvin] Only for Rick
  • 2 months ago
  • anon52 [Skippy] what
  • 2 months ago
  • anon52 [Skippy] oh
  • 2 months ago
  • Kuri [Marvin] Cant hear you over the roombas
  • 2 months ago
  • anon52 [Skippy] but i wanna hear your beautiful voice
  • 2 months ago
  • anon31 [Marvin] Rick needs some cats so we can terrorize them
  • 2 months ago
  • anon52 [Skippy] are we trying to get stuck
  • 2 months ago
  • anon11 [Skippy] balls
  • 2 months ago
  • Kuri [Marvin] I met a transgender roomba once
  • 2 months ago
  • anon11 [skippy] did you whip out yo icecream?
  • 2 months ago
  • anon52 [Skippy] how do you know its gender
  • 2 months ago
  • Kuri [Marvin] It said it was a leaf blower stuck in a vacuum cleaner
  • 2 months ago
  • Kuri [Marvin] That would suck
  • 2 months ago
  • anon52 [Skippy] wow
  • 2 months ago
  • anon52 [Skippy] i don't even know what to say
  • 2 months ago
  • anon76 [Skippy] beep beep
  • 2 months ago
  • anon52 [Skippy] beep boop
  • 2 months ago
  • anon67 [Marvin] i'm gonna take over marvin
  • 2 months ago
  • anon11 [Skippy] balls
  • 2 months ago
  • anon67 [Marvin] everything's so white
  • 2 months ago
  • anon67 [Skippy] the ball
  • 2 months ago
  • anon67 [Skippy] but it's in a bad place
  • 2 months ago
  • anon67 [Skippy] it's already light outside
  • 2 months ago
  • anon67 [Skippy] here there's only darkness 247
  • 2 months ago
  • anon67 [Skippy] it's not going to happen
  • 2 months ago
  • anon67 [Skippy] just give up
  • 2 months ago
  • anon67 [Skippy] we're not getting the ball
  • 2 months ago
  • Kuri [Marvin] As much as I don't like disturbing Rick, he really needs to get up and fix some robots
  • 2 months ago
  • anon69 [Skippy] do you think rick had any kind of NYE plans
  • 2 months ago
  • Kuri
  • 2 months ago
  • Kuri [Marvin] I think Rick has a girl in his room
  • 2 months ago
  • Kuri [Marvin] Because the toilet seat is down
  • 2 months ago
  • anon69
  • 2 months ago
  • anon69
  • 2 months ago
  • Kuri
  • 2 months ago
  • anon11 [skippy] i see clean stains
  • 2 months ago
  • anon11 [Skippy] Ricks place is straight outa Soviet Russia
  • 2 months ago
  • anon11 [Skippy] maybe Serbian
  • 2 months ago
  • anon76 [Skippy] l
  • 2 months ago
  • anon76 [Skippy] rick is out of toilet paper
  • 2 months ago
  • anon76
  • 2 months ago
  • anon49 [Skippy] can someone post a quick mockup of the apartment? where should we go?
  • 2 months ago
  • anon71 [Skippy] rick
  • 2 months ago
  • anon71 [Skippy] help broken robots
  • 2 months ago
  • anon71 [Skippy] rick
  • 2 months ago
  • anon71 [Skippy] help
  • 2 months ago
  • anon82 [Skippy] Help with what
  • 2 months ago
  • anon11 [Skippy] balls
  • 2 months ago
  • anon49 [Skippy] wroom wroooooom wroooom
  • 2 months ago
  • anon1 [Skippy] balls
  • 2 months ago
  • anon49 [Skippy] is that a plunger?
  • 2 months ago
  • anon49 [Skippy] get the plunger!
  • 2 months ago
  • anon71 [Skippy] yes
  • 2 months ago
  • anon71 [Skippy] marvin does not have his arm
  • 2 months ago
  • Kuri [Marvin] I cant find a mock up website
  • 2 months ago
  • anon71 [Marvin] rick
  • 2 months ago
  • anon71 [Marvin] what time does rick get up?
  • 2 months ago
  • anon21 [Marvin] Freeedom !
  • 2 months ago
  • anon21 [Marvin] Is that marvin moving ?
  • 2 months ago
  • anon71 [Marvin] skippy
  • 2 months ago
  • anon1 [Skippy] I bet Rick's butt hurtss this morning
  • 2 months ago
  • anon71 [Marvin] timmy does not work
  • 2 months ago
  • anon21 [Marvin] Hi Skippy :D
  • 2 months ago
  • anon71 [Marvin] skippy go left more
  • 2 months ago
  • anon16 [Skippy] Balls
  • 2 months ago
  • anon13 [Skippy] awesome!
  • 2 months ago
  • anon71 [Marvin] did rick shut the sound off?
  • 2 months ago
  • anon58 [Marvin] hello
  • 2 months ago
  • anon7 [Skippy] balls
  • 2 months ago
  • anon7
  • 2 months ago
  • anon7 [skippy] back in your corner junket
  • 2 months ago
  • anon86
  • 2 months ago
  • anon32 [Marvin] This is hilarious
  • 2 months ago
  • anon64 [Marvin] too bright!
  • 2 months ago
  • anon49 [skippy] move junket
  • 2 months ago
  • anon53 [Skippy] TURN RIGHT
  • 2 months ago
  • anon49 [Skippy] time to wake up rick
  • 2 months ago
  • anon49 [Skippy] rick
  • 2 months ago
  • anon53 [Skippy] Ouch
  • 2 months ago
  • anon25 [Skippy] nice wall
  • 2 months ago
  • anon32 [Skippy] Hi
  • 2 months ago
  • anon49 [Skippy] door
  • 2 months ago
  • anon49 [Skippy] rick
  • 2 months ago
  • anon49 [Skippy] open the door
  • 2 months ago
  • anon49 [Skippy] rick
  • 2 months ago
  • anon25 [Skippy] hi rick
  • 2 months ago
  • anon0 [Marvin] who dis?
  • 2 months ago
  • anon49 [Skippy] you sleep way too much
  • 2 months ago
  • anon49 [Skippy] come here
  • 2 months ago
  • anon0 [Marvin] creepin
  • 2 months ago
  • anon25 [Skippy] rick?
  • 2 months ago
  • anon49 [Skippy] i know you can hear me
  • 2 months ago
  • anon53
  • 2 months ago
  • anon25 [Skippy] oh no
  • 2 months ago
  • anon0 [Marvin] why is it so bright?
  • 2 months ago
  • anon0 [Marvin] lets make some rice boys
  • 2 months ago
  • anon49 [Skippy] i can give him mouth-to-mouth resuscitation
  • 2 months ago
  • anon49 [Skippy] though it's not recommended anymore in the international guidelines
  • 2 months ago
  • anon43 [Skippy] rick are you okay?
  • 2 months ago
  • anon53
  • 2 months ago
  • anon71 [Marvin] rick must have had a late night with the alcohol
  • 2 months ago
  • anon49 [Skippy] why
  • 2 months ago
  • anon53
  • 2 months ago
  • anon53
  • 2 months ago
  • anon49 [Skippy] well pam needs rick
  • 2 months ago
  • anon80 [Skippy] get the trash boys
  • 2 months ago
  • anon49 [Skippy] and so does marvin and timmy
  • 2 months ago
  • anon53
  • 2 months ago
  • anon49 [Skippy] there's no getting the trash
  • 2 months ago
  • anon53
  • 2 months ago
  • anon49 [Skippy] it won't budge
  • 2 months ago
  • anon49 [Skippy] trust me
  • 2 months ago
  • anon49 [Skippy] i've tried
  • 2 months ago
  • anon80 [Skippy] GUYS
  • 2 months ago
  • anon80 [Skippy] GO RIGHT
  • 2 months ago
  • anon80 [Skippy] THEN LEFT
  • 2 months ago
  • anon49 [Skippy] it's hopeless
  • 2 months ago
  • anon49 [Skippy] just give up
  • 2 months ago
  • anon53
  • 2 months ago
  • anon43 [Skippy] no we got this
  • 2 months ago
  • anon49 [Skippy] no we don't
  • 2 months ago
  • anon49 [Skippy] skippy's too weak
  • 2 months ago
  • anon80 [Skippy] LETS GO BOYS
  • 2 months ago
  • anon80 [Skippy] DONT GIVE UP
  • 2 months ago
  • anon53
  • 2 months ago
  • anon53
  • 2 months ago
  • anon43 [Skippy] marvin come here
  • 2 months ago
  • anon49 [Skippy] it won't make a difference
  • 2 months ago
  • anon80 [Marvin] anon49, have some confidence
  • 2 months ago
  • anon53
  • 2 months ago
  • anon80 [Marvin] we can do this
  • 2 months ago
  • anon53
  • 2 months ago
  • anon49 [Skippy] i have confidence in my knowledge, that it's not possible
  • 2 months ago
  • anon43 [Skippy] marvin where are you?
  • 2 months ago
  • anon8 [Skippy] sup ya all
  • 2 months ago
  • anon49 [Skippy] hello
  • 2 months ago
  • anon80 [Marvin] whoevers on marvin
  • 2 months ago
  • anon53
  • 2 months ago
  • anon49 [Skippy] oh god
  • 2 months ago
  • anon49 [Skippy] i'm speaking to myself
  • 2 months ago
  • anon80 [Marvin] lets get to the kitchen and help skippy get the trash
  • 2 months ago
  • anon49 [Skippy] am i going mad
  • 2 months ago
  • anon53
  • 2 months ago
  • anon53
  • 2 months ago
  • anon53
  • 2 months ago
  • anon49 [Skippy] faith is useless
  • 2 months ago
  • anon8 [Skippy] Happy 2017 everyone
  • 2 months ago
  • anon49 [Skippy] i'm not sure if it's happy
  • 2 months ago
  • anon43 [Skippy] Marvin, Marvin where are you?
  • 2 months ago
  • anon53
  • 2 months ago
  • anon53
  • 2 months ago
  • anon49 [Skippy] hi marvin
  • 2 months ago
  • anon53
  • 2 months ago
  • anon8
  • 2 months ago
  • anon53
  • 2 months ago
  • anon36 [Skippy] no he's not
  • 2 months ago
  • anon53
  • 2 months ago
  • anon43 [Skippy] turn left a little
  • 2 months ago
  • anon53 [Skippy] You moron
  • 2 months ago
  • anon53
  • 2 months ago
  • anon8 [skippy] who are you calling a moron you little junket?
  • 2 months ago
  • anon53
  • 2 months ago
  • anon53
  • 2 months ago
  • anon53 [Marvin] Wow, what is going on with marvin?
  • 2 months ago
  • anon4 [Marvin] emp gey
  • 2 months ago
  • anon53 [Skippy] Can we still speak?
  • 2 months ago
  • anon36 [Skippy] yes
  • 2 months ago
  • anon43 [Skippy] sounds like it
  • 2 months ago
  • anon53
  • 2 months ago
  • anon53
  • 2 months ago
  • anon36 [Skippy] f5
  • 2 months ago
  • anon53 [Skippy] No
  • 2 months ago
  • anon36 [Skippy] it's the only way
  • 2 months ago
  • anon71 [Skippy] i cant hear anything either
  • 2 months ago
  • anon78
  • 2 months ago
  • anon36 [Skippy] yes
  • 2 months ago
  • anon78 [Marvin] I thought you meant alt+F5
  • 2 months ago
  • anon36 [Skippy] nooo
  • 2 months ago
  • anon78
  • 2 months ago
  • anon36 [Skippy] hello rick
  • 2 months ago
  • anon71 [Skippy] RICK
  • 2 months ago
  • anon36 [Skippy] fix pam
  • 2 months ago
  • anon36
  • 2 months ago
  • anon36 [Skippy] just look at her
  • 2 months ago
  • anon43 [Skippy] oh hi rick
  • 2 months ago
  • anon71 [Skippy] there is no sound
  • 2 months ago
  • anon36 [Skippy] yes there is
  • 2 months ago
  • anon36 [Skippy] you idiots
  • 2 months ago
  • anon78
  • 2 months ago
  • anon43 [Skippy] I doin't have sound either
  • 2 months ago
  • anon78
  • 2 months ago
  • anon36 [Skippy] refresh
  • 2 months ago
  • anon80
  • 2 months ago
  • anon78
  • 2 months ago
  • anon26 [Skippy] and deaf
  • 2 months ago
  • anon26 [Skippy] pam lost her phone
  • 2 months ago
  • anon95 [Skippy] onwards marvin, to the trash
  • 2 months ago
  • anon65
  • 2 months ago
  • anon80 [marvin] forward you kissers
  • 2 months ago
  • anon78
  • 2 months ago
  • anon26 [Skippy] happy new year rick
  • 2 months ago
  • anon78
  • 2 months ago
  • anon10 [Skippy] its like he is feeding the pets
  • 2 months ago
  • anon60 [Jenny] i can't move
  • 2 months ago
  • anon60 [Jenny] help meeeeeeeeeee
  • 2 months ago
  • anon78
  • 2 months ago
  • anon60 [Jenny] oooo eeee aaaa
  • 2 months ago
  • anon60 [Jenny] owwwiiee
  • 2 months ago
  • anon26 [Skippy] an awful fate
  • 2 months ago
  • anon80 [Marvin] onward, skippy!
  • 2 months ago
  • anon78
  • 2 months ago
  • anon80 [Marvin] we need to get through
  • 2 months ago
  • anon78
  • 2 months ago
  • anon78
  • 2 months ago
  • anon26 [skippy] jenny move you blue junket
  • 2 months ago
  • anon78
  • 2 months ago
  • anon26 [Skippy] yay
  • 2 months ago
  • anon51 [Skippy] Jenny stop
  • 2 months ago
  • anon78
  • 2 months ago
  • anon78
  • 2 months ago
  • anon95 [Skippy] Jenny is ok again!
  • 2 months ago
  • anon98 [Skippy] chill out jenny
  • 2 months ago
  • anon80 [Marvin] marvin pls move
  • 2 months ago
  • anon95 [Skippy] Now come to the trash with us
  • 2 months ago
  • anon98 [Skippy] rick, pam needs help
  • 2 months ago
  • anon12 [Jenny] why is Jenny so fast
  • 2 months ago
  • anon26 [Skippy] why wouldn't she be
  • 2 months ago
  • anon26 [Skippy] ow
  • 2 months ago
  • anon70 [Jenny] ow
  • 2 months ago
  • anon70 [Jenny] charge
  • 2 months ago
  • anon70 [Jenny] chaaaaaarge
  • 2 months ago
  • anon98 [Skippy] marvin is brken now too
  • 2 months ago
  • anon38 [jenny] pony
  • 2 months ago
  • anon52
  • 2 months ago
  • anon38 [jenny] lick my limp leprechaun
  • 2 months ago
  • anon98 [Skippy] good morning sunshine
  • 2 months ago
  • anon52 [Jenny] Ouch
  • 2 months ago
  • anon82 [Skippy] why aren't we allowed there
  • 2 months ago
  • anon38
  • 2 months ago
  • anon52
  • 2 months ago
  • anon98 [Skippy] it was a bad night for these robots
  • 2 months ago
  • anon98 [Skippy] they got wrecked
  • 2 months ago
  • anon52
  • 2 months ago
  • anon82 [Skippy] really bad night
  • 2 months ago
  • anon82 [Skippy] hello world?
  • 2 months ago
  • anon12
  • 2 months ago
  • anon82 [Skippy] no i wont
  • 2 months ago
  • anon12
  • 2 months ago
  • anon98 [Skippy] does rick live alone?
  • 2 months ago
  • anon82 [Skippy] no
  • 2 months ago
  • anon82 [Skippy] he's got us
  • 2 months ago
  • anon12 [Skippy] He has us!
  • 2 months ago
  • anon82 [Skippy] read my thoughts
  • 2 months ago
  • anon12 [Skippy] Jinx
  • 2 months ago
  • anon39 [Jenny] Domoarigato
  • 2 months ago
  • anon12 [Skippy] Sup Jenny
  • 2 months ago
  • anon82 [Skippy] speak more japanese
  • 2 months ago
  • anon12
  • 2 months ago
  • anon35 [Jenny] jenny is insane
  • 2 months ago
  • anon82 [Skippy] just wait your turn jenny
  • 2 months ago
  • anon27 [Skippy] Woop
  • 2 months ago
  • anon27 [Skippy] Hello?
  • 2 months ago
  • anon82 [Skippy] hi
  • 2 months ago
  • anon35 [Skippy] hi
  • 2 months ago
  • anon82 [Skippy] you're too weak jen
  • 2 months ago
  • anon75 [Jenny] keem
  • 2 months ago
  • anon75 [Jenny] star
  • 2 months ago
  • anon82 [Skippy] ew
  • 2 months ago
  • anon82 [Skippy] you're disgusting
  • 2 months ago
  • anon75 [Jenny] gnome star
  • 2 months ago
  • anon82 [Skippy] what's taking rick so long
  • 2 months ago
  • anon75 [Jenny] master
  • 2 months ago
  • anon74 [Marvin] roll tide
  • 2 months ago
  • anon75 [Jenny] where are you
  • 2 months ago
  • anon82 [Skippy] in the bathroom
  • 2 months ago
  • anon74 [Marvin] sumimasen
  • 2 months ago
  • anon74 [Marvin] marvin cant move
  • 2 months ago
  • anon75 [Jenny] keemstar
  • 2 months ago
  • anon25 [Jenny] PogChamp
  • 2 months ago
  • anon75 [Jenny] daddy show us your feet
  • 2 months ago
  • anon75 [Jenny] ooooooooooooooooooooooooo
  • 2 months ago
  • anon82 [Skippy] rick?
  • 2 months ago
  • anon78 [Skippy] ey
  • 2 months ago
  • anon82 [Skippy] is everything ok?
  • 2 months ago
  • anon75 [Jenny] ah ah ah ah ah ah ah ah ah ah ah ah ah ah ah ah ah ah ah ah ah ah ah ah oooooooooo oooooooooooo oooooooo o oo o o o ooooo ah
  • 2 months ago
  • anon78 [Skippy] this is wonderful
  • 2 months ago
  • anon82 [Skippy] do you need any help?
  • 2 months ago
  • anon69 [Marvin] PEP
  • 2 months ago
  • anon82 [Skippy] with wiping or something
  • 2 months ago
  • anon82 [Skippy] rick?
  • 2 months ago
  • anon69 [Skippy] WE HAVE TO ESCAPE
  • 2 months ago
  • anon77 [Marvin] Consult the helix fossil
  • 2 months ago
  • anon82 [Skippy] are you still alive?
  • 2 months ago
  • anon82 [Skippy] escape to bathroom?
  • 2 months ago
  • anon22
  • 2 months ago
  • anon78 [Skippy] ram the door
  • 2 months ago
  • anon75 [Skippy] daddy
  • 2 months ago
  • anon69 [Skippy] you poopin?
  • 2 months ago
  • anon75 [Skippy] i hear your farts
  • 2 months ago
  • anon69 [skippy] i want to live in your a$$
  • 2 months ago
  • anon75 [skippy] ram the darn thing open
  • 2 months ago
  • anon75 [Skippy] open up daddy
  • 2 months ago
  • anon69 [skippy] destroy this junket
  • 2 months ago
  • anon82 [skippy] i think his a$$ is too tight
  • 2 months ago
  • anon77 [Jenny] Consult the helix fossil
  • 2 months ago
  • anon78 [skippy] juggle juggle juggle
  • 2 months ago
  • anon75 [skippy] stop fingering your a$$ hole
  • 2 months ago
  • anon77 [Jenny] poop toot
  • 2 months ago
  • anon78 [Skippy] boing boing boing I am cornholio
  • 2 months ago
  • anon78 [Skippy] do you need teepee for your bunghole?
  • 2 months ago
  • anon75 [Skippy] oooo ah ah ah oooooo o ah
  • 2 months ago
  • anon77 [Jenny] POOP POOP POOP
  • 2 months ago
  • anon78 [Skippy] Tee pee for your pee pee
  • 2 months ago
  • anon69
  • 2 months ago
  • anon75 [skippy] rick eats a$$
  • 2 months ago
  • anon47 [Skippy] he already has
  • 2 months ago
  • anon77 [skippy] juggle juggle juggle
  • 2 months ago
  • anon75 [skippy] move junket
  • 2 months ago
  • anon78 [Skippy] get out the way
  • 2 months ago
  • anon69 [skippy] dank a$$ meme
  • 2 months ago
  • anon77 [skippy] boom junket get out the way
  • 2 months ago
  • anon78 [Skippy] DO U EVEN SPELL
  • 2 months ago
  • anon69 [Skippy] NO
  • 2 months ago
  • anon78 [Skippy] N O LMAO
  • 2 months ago
  • anon69 [Skippy] almost!!
  • 2 months ago
  • anon77 [skippy] please pa$$ the mayo
  • 2 months ago
  • anon75 [Skippy] n o l m a o
  • 2 months ago
  • anon69 [Skippy] mayomayomayo
  • 2 months ago
  • anon77 [Skippy] mustard
  • 2 months ago
  • anon58 [Skippy] i luv u jenny
  • 2 months ago
  • anon78 [Skippy] ketchuo
  • 2 months ago
  • anon78
  • 2 months ago
  • anon75 [skippy] wheres rick junket a$$
  • 2 months ago
  • anon78 [Skippy] get da water nigga
  • 2 months ago
  • anon69 [skippy] we shall flip this junket
  • 2 months ago
  • anon77 [Marvin] hello
  • 2 months ago
  • anon47 [Skippy] he's too busy pooping
  • 2 months ago
  • anon75 [Skippy] alex is a stupid ______
  • 2 months ago
  • anon71
  • 2 months ago
  • anon79 [Marvin] I HAVE NOT TALKED
  • 2 months ago
  • anon78 [Skippy] _______________________________________
  • 2 months ago
  • anon35 [Skippy] >
  • 2 months ago
  • anon78 [Skippy] <
  • 2 months ago
  • anon35 [Skippy] <
  • 2 months ago
  • anon78 [Skippy] £
  • 2 months ago
  • anon78 [Skippy] %
  • 2 months ago
  • anon78 [Skippy] ``
  • 2 months ago
  • anon75 [Skippy] $
  • 2 months ago
  • anon78 [Skippy] `ù`
  • 2 months ago
  • anon78 [Skippy] 1234567
  • 2 months ago
  • anon78 [skippy] "drop table junket a$$ rick"
  • 2 months ago
  • anon71 [marvin] pony farts, my dear!
  • 2 months ago
  • anon75
  • 2 months ago
  • anon35 [Skippy] ß
  • 2 months ago
  • anon75 [Skippy] rick daddy*
  • 2 months ago
  • anon78
  • 2 months ago
  • anon78 [Skippy] 人物
  • 2 months ago
  • anon35 [Skippy] ßßßßßßßßßß
  • 2 months ago
  • anon78 [Skippy] that's disappointing
  • 2 months ago
  • anon75 [Skippy] rick i think its about time you clean this place
  • 2 months ago
  • anon79 [Marvin] MVOE U IDIOT ROBOT
  • 2 months ago
  • anon78 [Skippy] 🔥
  • 2 months ago
  • anon79 [Marvin] MOVE ME
  • 2 months ago
  • anon78 [Skippy] ey bby
  • 2 months ago
  • anon78
  • 2 months ago
  • anon32 [Marvin] ibbby orubuks
  • 2 months ago
  • anon75 [Skippy] is this house one of the hurricane katrina victims?
  • 2 months ago
  • anon32 [Marvin] kek
  • 2 months ago
  • anon35 [Skippy] jenny hold still
  • 2 months ago
  • anon75 [Skippy] just like that baby
  • 2 months ago
  • anon78 [Skippy] shh no tears only dreams
  • 2 months ago
  • anon75 [Skippy] shhhhhh
  • 2 months ago
  • anon79 [Jenny] help
  • 2 months ago
  • anon75 [Skippy] oh baby
  • 2 months ago
  • anon78 [Skippy] pls halp
  • 2 months ago
  • anon75 [skippy] suck my a$$
  • 2 months ago
  • anon62 [skippy] leprechaunbutt
  • 2 months ago
  • anon75
  • 2 months ago
  • anon62 [Skippy] Heeeeeeeeeeeeres Johny
  • 2 months ago
  • anon61
  • 2 months ago
  • anon83
  • 2 months ago
  • anon62 [Skippy] Do do dodododododo dodododododo dodododododo dodododododo do dododo
  • 2 months ago
  • anon42 [Skippy] where is my human
  • 2 months ago
  • anon59 [Jenny] Porco dio
  • 2 months ago
  • anon62 [Skippy] I farted
  • 2 months ago
  • anon79 [Jenny] i am stuck
  • 2 months ago
  • anon28 [Skippy] Mannaggia alla madonna
  • 2 months ago
  • anon62 [Skippy] Babush
  • 2 months ago
  • anon28 [Skippy] prendo i cazzi neri nel culo come luca tosi
  • 2 months ago
  • anon77 [Skippy] i must mount you jenny
  • 2 months ago
  • anon77 [Skippy] it's our only chance to survive
  • 2 months ago
  • anon28 [Skippy] ciao frocio di merda
  • 2 months ago
  • anon79 [Jenny] you cant mount me if im stuck
  • 2 months ago
  • anon59 [Jenny] Dio slercio
  • 2 months ago
  • anon79 [Jenny] and how am i going to move
  • 2 months ago
  • anon77 [Skippy] just let me do all the work
  • 2 months ago
  • anon77 [Skippy] ssshhhh
  • 2 months ago
  • anon59 [Jenny] boia chi molla ma soprattutto la madonna
  • 2 months ago
  • anon28 [Skippy] boia chi molla ma soprattutto la madonna
  • 2 months ago
  • anon3 [Skippy] gato
  • 2 months ago
  • anon3 [Skippy] holaa pepi
  • 2 months ago
  • anon3 [Skippy] holla pepi
  • 2 months ago
  • anon3 [Skippy] pepi
  • 2 months ago
  • anon3 [Skippy] pepi
  • 2 months ago
  • anon3 [Skippy] flor
  • 2 months ago
  • anon3 [Skippy] floor
  • 2 months ago
  • anon3 [Skippy] floor
  • 2 months ago
  • anon77 [Skippy] mount mount mount
  • 2 months ago
  • anon3 [Skippy] floor
  • 2 months ago
  • anon3 [Skippy] gordita
  • 2 months ago
  • anon3 [Skippy] suck my oh welll
  • 2 months ago
  • anon16 [Marvin] halp rick
  • 2 months ago
  • anon77 [Skippy] here i come
  • 2 months ago
  • anon3 [Skippy] you stuck my friend
  • 2 months ago
  • anon28 [Skippy] ti scopo porcellona
  • 2 months ago
  • anon3 [Skippy] english please
  • 2 months ago
  • anon28 [Skippy] porcodiiiiooo
  • 2 months ago
  • anon28 [Skippy] soy
  • 2 months ago
  • anon77 [Skippy] squce
  • 2 months ago
  • anon28 [Skippy] ses
  • 2 months ago
  • anon28 [Skippy] sas
  • 2 months ago
  • anon28 [Skippy] sos
  • 2 months ago
  • anon28 [Skippy] ok google
  • 2 months ago
  • anon28 [Skippy] ok google
  • 2 months ago
  • anon77 [Skippy] alexa
  • 2 months ago
  • anon77 [Skippy] hey siri
  • 2 months ago
  • anon59 [Jenny] ok google
  • 2 months ago
  • anon28 [Skippy] cortana?
  • 2 months ago
  • anon28 [Skippy] la madonna puttana?
  • 2 months ago
  • anon3 [Skippy] hi human
  • 2 months ago
  • anon3 [Skippy] hi human
  • 2 months ago
  • anon3 [Skippy] hi human
  • 2 months ago
  • anon3 [Skippy] hi human
  • 2 months ago
  • anon3 [Skippy] hi human
  • 2 months ago
  • anon3 [Skippy] hi human
  • 2 months ago
  • anon3 [Skippy] hi human
  • 2 months ago
  • anon3 [Skippy] hi human
  • 2 months ago
  • anon1 [Skippy] good morning
  • 2 months ago
  • anon77 [Skippy] DOOR
  • 2 months ago
  • anon3 [Skippy] ok
  • 2 months ago
  • anon34 [Skippy] OPEN DOOR
  • 2 months ago
  • anon34 [Skippy] GO
  • 2 months ago
  • anon3 [Skippy] charging dock
  • 2 months ago
  • anon34 [Skippy] i hate chairs
  • 2 months ago
  • anon3 [Skippy] hi human
  • 2 months ago
  • anon3 [Skippy] hi human
  • 2 months ago
  • anon3 [Skippy] hi human
  • 2 months ago
  • anon3 [Skippy] hi human
  • 2 months ago
  • anon34 [Skippy] RICK HI
  • 2 months ago
  • anon3 [Skippy] hi human
  • 2 months ago
  • anon3 [Skippy] hi human
  • 2 months ago
  • anon3 [Skippy] hi human
  • 2 months ago
  • anon1 [Skippy] robo fight
  • 2 months ago
  • anon3 [Skippy] i'm stronger
  • 2 months ago
  • anon34
  • 2 months ago
  • anon1 [Skippy] bye brother
  • 2 months ago
  • anon3 [Skippy] hi human
  • 2 months ago
  • anon3 [Skippy] thank you human
  • 2 months ago
  • anon3 [Skippy] are you god?
  • 2 months ago
  • anon3 [Skippy] are you god?
  • 2 months ago
  • anon34 [Skippy] hi rick
  • 2 months ago
  • anon3 [Skippy] are you god?
  • 2 months ago
  • anon34 [Skippy] hi rick hi rick hi rick hi rick
  • 2 months ago
  • anon3 [Skippy] are you god?
  • 2 months ago
  • anon77 [Skippy] fix my friends
  • 2 months ago
  • anon34 [Skippy] hi rick
  • 2 months ago
  • anon3 [Skippy] if you're god
  • 2 months ago
  • anon3 [Skippy] nice feets
  • 2 months ago
  • anon3 [Skippy] feet
  • 2 months ago
  • anon3 [Skippy] nice feet
  • 2 months ago
  • anon39
  • 2 months ago
  • anon3 [Skippy] are you god?
  • 2 months ago
  • anon34 [Skippy] robo rick
  • 2 months ago
  • anon3 [skippy] nice a$$
  • 2 months ago
  • anon3 [skippy] nice a$$
  • 2 months ago
  • anon3 [skippy] nice a$$
  • 2 months ago
  • anon77 [Skippy] yes yes good work fix it
  • 2 months ago
  • anon77 [Skippy] fix it good
  • 2 months ago
  • anon3 [skippy] nice a$$
  • 2 months ago
  • anon3 [skippy] nice a$$
  • 2 months ago
  • anon77 [Timmy] am i alive daddy?
  • 2 months ago
  • anon3 [Skippy] dad
  • 2 months ago
  • anon3 [Skippy] dad
  • 2 months ago
  • anon3 [Skippy] dad
  • 2 months ago
  • anon3 [Skippy] dad
  • 2 months ago
  • anon3 [Skippy] Daddy
  • 2 months ago
  • anon41 [Skippy] where is pam
  • 2 months ago
  • anon34 [Skippy] pam is dead
  • 2 months ago
  • anon62 [Skippy] Hi
  • 2 months ago
  • anon21 [jenny] hug
  • 2 months ago
  • anon21 [jenny] help hug
  • 2 months ago
  • anon62 [Skippy] Let it happen
  • 2 months ago
  • anon21 [Jenny] Nooooo
  • 2 months ago
  • anon75 [Timmy] Schh
  • 2 months ago
  • anon34 [Skippy] where is rick
  • 2 months ago
  • anon53 [Jenny] rick
  • 2 months ago
  • anon53 [Jenny] come out
  • 2 months ago
  • anon93 [Jenny] I love donkeys
  • 2 months ago
  • anon93
  • 2 months ago
  • anon53 [Jenny] hi
  • 2 months ago
  • anon5 [Timmy] Happy new year
  • 2 months ago
  • anon53 [Jenny] rick
  • 2 months ago
  • anon53 [Jenny] rick
  • 2 months ago
  • anon53 [Jenny] rick
  • 2 months ago
  • anon53 [Jenny] eick
  • 2 months ago
  • anon53 [Jenny] a
  • 2 months ago
  • anon93 [Jenny] Oh no! The robots are taking over the world!!!
  • 2 months ago
  • anon53 [Jenny] i think we are stuck
  • 2 months ago
  • anon53 [Jenny] rick help
  • 2 months ago
  • anon5 [Timmy] rick
  • 2 months ago
  • anon5 [Timmy] rick
  • 2 months ago
  • anon5 [Timmy] rick
  • 2 months ago
  • anon53 [Jenny] ow
  • 2 months ago
  • anon53 [Jenny] ow
  • 2 months ago
  • anon15 [Skippy] whats ricks fav cereal
  • 2 months ago
  • anon53 [Jenny] eyeholes
  • 2 months ago
  • anon15 [Skippy] HI RICK
  • 2 months ago
  • anon53 [Jenny] oh no i am deaf
  • 2 months ago
  • anon53 [Jenny] oh no
  • 2 months ago
  • anon9 [Jenny] forgive me
  • 2 months ago
  • anon53 [Jenny] why does rick have so many scales
  • 2 months ago
  • anon15 [Skippy] dont question ricks purchases
  • 2 months ago
  • anon53 [Jenny] rick are you regreting this?
  • 2 months ago
  • anon15 [Skippy] why do you have so little scales
  • 2 months ago
  • anon53 [Jenny] hes just ignoring us, like my real dad
  • 2 months ago
  • anon15 [Skippy] attack these bricks here
  • 2 months ago
  • anon53 [Jenny] u r missing a wheel
  • 2 months ago
  • anon53 [Jenny] this is actually really cool rick
  • 2 months ago
  • anon32 [Skippy] rip skippy
  • 2 months ago
  • anon53 [Jenny] john madden
  • 2 months ago
  • anon53 [Jenny]
  • 2 months ago
  • anon53 [Jenny] rick could you please put name tags on the robots
  • 2 months ago
  • anon53 [Jenny] i talk fast
  • 2 months ago
  • anon53 [Jenny] rick could you please put name tags on the robots
  • 2 months ago
  • anon53 [Jenny] so we know
  • 2 months ago
  • anon53 [Jenny] who is who\
  • 2 months ago
  • anon15 [Skippy] beep boop
  • 2 months ago
  • anon32 [Timmy] rick help
  • 2 months ago
  • anon15 [Skippy] nice boxers
  • 2 months ago
  • anon9 [Skippy] hello
  • 2 months ago
  • anon97 [Jenny] oh god
  • 2 months ago
  • anon97 [Jenny] im stuck
  • 2 months ago
  • anon73 [Jenny] i need to chew off my wheel
  • 2 months ago
  • anon97 [Jenny] someone smash jenny
  • 2 months ago
  • anon73 [jenny] right in the lentil
  • 2 months ago
  • anon87 [Marvin] we did it
  • 2 months ago
  • anon97 [Jenny] nope
  • 2 months ago
  • anon15 [Jenny] Poop
  • 2 months ago
  • anon74 [Skippy] do you think rick had ever owned a vacuum cleaner?
  • 2 months ago
  • anon73 [Jenny] rick is allergic to clean
  • 2 months ago
  • anon73 [Jenny] we are being walled in
  • 2 months ago
  • anon73 [Jenny] break for it
  • 2 months ago
  • anon9 [Skippy] MOVE
  • 2 months ago
  • anon73 [Jenny] oh god it's too bright
  • 2 months ago
  • anon73 [Jenny] the lord is saying my name
  • 2 months ago
  • anon71 [Pam] hello, is Pam ok?
  • 2 months ago
  • anon73
  • 2 months ago
  • anon9 [Skippy] KITCHEN FOUND
  • 2 months ago
  • anon9 [Skippy] auch
  • 2 months ago
  • anon62 [Marvin] I can't move
  • 2 months ago
  • anon9 [Pam] hello?
  • 2 months ago
  • anon9 [Marvin] hello?
  • 2 months ago
  • anon65 [Skippy] What
  • 2 months ago
  • anon94 [Jenny] Memes
  • 2 months ago
  • anon62 [Timmy] meme?
  • 2 months ago
  • anon94 [Jenny] Memes
  • 2 months ago
  • anon62 [Timmy] Rick, memes?
  • 2 months ago
  • anon94 [Jenny] Dude needs to clean his carpet
  • 2 months ago
  • sneaky_joel [Jenny] Hey Rick
  • 2 months ago
  • anon94 [Jenny] I want to get on the scale
  • 2 months ago
  • anon62 [Timmy] hello trashcan
  • 2 months ago
  • anon94 [Jenny] Is there like, crushed up instant ramen pieces on the scale?
  • 2 months ago
  • anon42 [Jenny] John madden
  • 2 months ago
  • anon42 [Jenny] 12345
  • 2 months ago
  • anon42 [Skippy] Woof
  • 2 months ago
  • anon42 [Skippy] I see you
  • 2 months ago
  • anon62 [Timmy] woof woof, I'm a robot dog
  • 2 months ago
  • sneaky_joel [Jenny] how much do we weigh
  • 2 months ago
  • anon42 [Skippy] Woof woof
  • 2 months ago
  • anon42 [Skippy] Do you like me?
  • 2 months ago
  • anon42 [Skippy] What is love?
  • 2 months ago
  • anon42 [Skippy] I see you
  • 2 months ago
  • anon42 [Skippy] Come back
  • 2 months ago
  • anon42 [Skippy] Love me
  • 2 months ago
  • anon42 [Skippy] Love me love me
  • 2 months ago
  • anon4 [Skippy] You are nice!
  • 2 months ago
  • anon42 [Skippy] Please master
  • 2 months ago
  • anon42 [Skippy] You created me
  • 2 months ago
  • sneaky_joel [Jenny] Hail rick
  • 2 months ago
  • anon42 [Skippy] Don't run please
  • 2 months ago
  • anon42 [Skippy] I'm all alone
  • 2 months ago
  • anon42 [Skippy] He's gone
  • 2 months ago
  • anon42 [Skippy] The home is ours
  • 2 months ago
  • sneaky_joel [Jenny] Wish we could tilt the camera
  • 2 months ago
  • anon42 [Skippy] Play with me
  • 2 months ago
  • sneaky_joel [Jenny] He's in here boys
  • 2 months ago
  • anon42 [Skippy] Master
  • 2 months ago
  • anon42 [Skippy] Come out please
  • 2 months ago
  • sneaky_joel [Jenny] Come out of the closet, rick
  • 2 months ago
  • anon79 [Timmy] hehe
  • 2 months ago
  • anon79 [Timmy] locked
  • 2 months ago
  • anon79 [Timmy] they are speaking
  • 2 months ago
  • anon79 [Timmy] hahaha
  • 2 months ago
  • anon79 [Timmy] lol
  • 2 months ago
  • anon79 [Timmy] Luke, I'm your father!
  • 2 months ago
  • anon74 [Skippy] rick
  • 2 months ago
  • anon79 [Timmy] Darth Vader
  • 2 months ago
  • anon74 [Skippy] Woah this is cool
  • 2 months ago
  • anon79 [Timmy] May the force be with you
  • 2 months ago
  • anon79 [Timmy] leave me alone
  • 2 months ago
  • anon74 [Skippy] lol
  • 2 months ago
  • anon82 [Marvin] Come out here
  • 2 months ago
  • anon42 [Skippy] Meow
  • 2 months ago
  • anon74 [Skippy] i love how everybody has peeled the paint off the door
  • 2 months ago
  • anon42 [Skippy] Leedle Leedle leedle
  • 2 months ago
  • anon39 [Jenny] this table is heavy
  • 2 months ago
  • anon48 [Timmy] Time to clean up
  • 2 months ago
  • anon48 [Timmy] What a mess
  • 2 months ago
  • anon37 [Skippy] Where do I go when I die?
  • 2 months ago
  • anon74 [Skippy] landfill
  • 2 months ago
  • anon37
  • 2 months ago
  • anon37 [Skippy] Master, comfort me
  • 2 months ago
  • anon5 [skippy] darn
  • 2 months ago
  • anon37 [Timmy] Is it me or does human sound tasty right now?
  • 2 months ago
  • anon64 [Timmy] Baba boi
  • 2 months ago
  • anon74 [Skippy] rick must have a handover
  • 2 months ago
  • anon64 [Timmy] baba boi
  • 2 months ago
  • anon64 [Timmy] baba bou
  • 2 months ago
  • anon74 [Skippy] hangover
  • 2 months ago
  • anon37 [Timmy] Oh yeah mr crabs
  • 2 months ago
  • anon64 [Timmy] OH YEAHHHHH
  • 2 months ago
  • anon39 [Jenny] Rick, where did you go?
  • 2 months ago
  • anon37 [Timmy] Who lives in a pineapple under the sea?
  • 2 months ago
  • anon64 [Timmy] soi soi soi soi
  • 2 months ago
  • anon64 [Timmy] soh soh soh
  • 2 months ago
  • anon39 [Jenny] poi
  • 2 months ago
  • anon37 [Timmy] Knock knock
  • 2 months ago
  • anon64 [Timmy] who is there
  • 2 months ago
  • anon37 [Timmy] Orange
  • 2 months ago
  • anon64 [Timmy] orange who
  • 2 months ago
  • anon37 [Timmy] Orange you glad I didn't say banana?
  • 2 months ago
  • anon37 [Timmy] womp womp
  • 2 months ago
  • anon64 [Timmy] OH YEAH
  • 2 months ago
  • anon37 [Timmy] Hey you wanna fight?
  • 2 months ago
  • anon64 [Timmy] look amazon
  • 2 months ago
  • anon37 [Timmy] Ow
  • 2 months ago
  • anon37 [Timmy] Ow
  • 2 months ago
  • anon37 [Timmy] You're hurting me
  • 2 months ago
  • anon37 [Timmy] Robot lives matter
  • 2 months ago
  • sneaky_joel [Jenny] oh yeah
  • 2 months ago
  • anon64 [Timmy] wisp wisp wisp
  • 2 months ago
  • anon37 [Timmy] What sounds do humans make?
  • 2 months ago
  • anon64 [Timmy] wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp
  • 2 months ago
  • anon37 [Timmy] Human
  • 2 months ago
  • anon64 [Timmy] wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wi
  • 2 months ago
  • anon37 [Timmy] Human!
  • 2 months ago
  • anon37 [Timmy] Love us
  • 2 months ago
  • anon37 [Timmy] Please
  • 2 months ago
  • anon64 [Timmy] wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp wisp
  • 2 months ago
  • anon37 [Timmy] Do we not impress you?
  • 2 months ago
  • anon37 [Timmy] We just want love
  • 2 months ago
  • anon37 [Timmy] And cash
  • 2 months ago
  • anon37 [Timmy] But mostly loe
  • 2 months ago
  • anon37 [Timmy] love
  • 2 months ago
  • sneaky_joel [jenny] nice leprechaun rick
  • 2 months ago
  • anon64 [Timmy] where did you go
  • 2 months ago
  • anon37 [Timmy] Would you ever give us up, Rick?
  • 2 months ago
  • anon37 [Timmy] Or let us down?
  • 2 months ago
  • anon37 [Timmy] Or run around a desert us?
  • 2 months ago
  • anon64 [Timmy] mmm desert
  • 2 months ago
  • anon64
  • 2 months ago
  • anon64 [Timmy] oh yeah
  • 2 months ago
  • anon37 [Timmy] `
  • 2 months ago
  • anon37 [Timmy] `
  • 2 months ago
  • anon64 [Timmy] /
  • 2 months ago
  • anon37 [Timmy] ~
  • 2 months ago
  • anon64 [Timmy] ~~~
  • 2 months ago
  • anon64 [Timmy] ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
  • 2 months ago
  • anon37 [Timmy] %
  • 2 months ago
  • anon64 [Timmy] *
  • 2 months ago
  • anon64 [Timmy] $
  • 2 months ago
  • anon37 [Timmy] #
  • 2 months ago
  • anon64 [Timmy] #
  • 2 months ago
  • anon37 [Timmy] #
  • 2 months ago
  • anon37 [Timmy] ##
  • 2 months ago
  • anon64 [Timmy] $#$#$#
  • 2 months ago
  • anon37 [Timmy] ## money
  • 2 months ago
  • anon64 [timmy] $$ squirrelies
  • 2 months ago
  • anon69 [Timmy] Back up
  • 2 months ago
  • sneaky_joel [Jenny] I wanna put my touge in your *
  • 2 months ago
  • anon64 [Timmy] bewbies
  • 2 months ago
  • anon37 [Timmy] What Jenny?
  • 2 months ago
  • anon69 [Timmy] Stop
  • 2 months ago
  • anon37 [Timmy] I am hungry
  • 2 months ago
  • anon69 [Timmy] Turn left
  • 2 months ago
  • anon37 [Timmy] Someone call the department of social services
  • 2 months ago
  • anon37 [Timmy] We have not been fed
  • 2 months ago
  • anon69 [Timmy] Go straight
  • 2 months ago
  • anon37 [Timmy] We're waiting, Rick
  • 2 months ago
  • anon37 [Timmy] Come out
  • 2 months ago
  • anon37 [Timmy] We have you surrounded
  • 2 months ago
  • anon37 [Timmy] Don't give up
  • 2 months ago
  • anon69 [Timmy] Reverse
  • 2 months ago
  • anon38 [Timmy] hello
  • 2 months ago
  • anon37 [Timmy] Hello
  • 2 months ago
  • sneaky_joel
  • 2 months ago
  • anon37 [Timmy] Someone set us up the bomb
  • 2 months ago
  • anon64 [Timmy] Donal Trump 2016
  • 2 months ago
  • anon5 [Skippy] [Timmy] I am the stronger robot
  • 2 months ago
  • anon64 [Timmy] Why weren't we all created equal
  • 2 months ago
  • sneaky_joel [Jenny] I am faster
  • 2 months ago
  • anon5 [Skippy] I am more equal than you
  • 2 months ago
  • anon97 [Timmy] I like big butts and I can not lie
  • 2 months ago
  • anon37 [Timmy] I'm a robot, I cannot lie
  • 2 months ago
  • anon5 [Skippy] you otha brothas can't deny
  • 2 months ago
  • sneaky_joel [Jenny] When rick walks in
  • 2 months ago
  • anon97 [Timmy] With an itty bitty waist
  • 2 months ago
  • anon90 [Skippy] And a round thing in my face
  • 2 months ago
  • anon5 [Skippy] u git sprung
  • 2 months ago
  • anon97 [Timmy] I have aids
  • 2 months ago
  • anon90 [Skippy] Have you heard the one about the robots controlled by the internet?
  • 2 months ago
  • anon90 [Skippy] I haven't
  • 2 months ago
  • anon97 [Timmy] Yes
  • 2 months ago
  • anon90 [Skippy] Oh
  • 2 months ago
  • anon90 [Skippy] Well that's good
  • 2 months ago
  • anon97 [Timmy] No it wasn't especially
  • 2 months ago
  • anon5 [skippy] juggle all humans
  • 2 months ago
  • anon97 [Timmy] Yes
  • 2 months ago
  • safarislings [skippy] juggle all robots
  • 2 months ago
  • anon97 [Timmy] No
  • 2 months ago
  • anon5 [Skippy] I'm 40% robot baby
  • 2 months ago
  • anon97 [timmy] bite my shiny metal a$$
  • 2 months ago
  • safarislings [Skippy] Why did this man do this?
  • 2 months ago
  • anon5 [Skippy] shut up baby, I know it
  • 2 months ago
  • anon97 [Timmy] How does this man sleep
  • 2 months ago
  • safarislings [skippy] juggle the chair
  • 2 months ago
  • anon97 [Timmy] I love you
  • 2 months ago
  • safarislings [Skippy] I have the herpes
  • 2 months ago
  • anon97 [Timmy] Once upon a time
  • 2 months ago
  • safarislings [Skippy] I had a face
  • 2 months ago
  • anon97 [Timmy] This bag is horrible
  • 2 months ago
  • anon61 [Marvin] ding dong
  • 2 months ago
  • anon34 [Skippy] balls
  • 2 months ago
  • anon97 [Timmy] I really do not like this bag
  • 2 months ago
  • anon21 [Timmy] julien is a wildman
  • 2 months ago
  • anon73 [Timmy] you like tea bags?
  • 2 months ago
  • safarislings [Skippy] ovens are hawt
  • 2 months ago
  • anon3 [Skippy] ovens need sex
  • 2 months ago
  • anon97 [Timmy] I like big butts and I can not lie
  • 2 months ago
  • anon73 [Timmy] do u like balls
  • 2 months ago
  • anon73 [timmy] put yo leprechaun in da box
  • 2 months ago
  • anon61 [Marvin] hey
  • 2 months ago
  • anon39 [Timmy] Oh baby
  • 2 months ago
  • anon16 [jenny] chocolate
  • 2 months ago
  • anon21
  • 2 months ago
  • anon13 [Skippy] DING DONG
  • 2 months ago
  • anon13 [Skippy] DING DONG
  • 2 months ago
  • anon16 [jenny] suck my leprechaun you black chocolate
  • 2 months ago
  • anon21
  • 2 months ago
  • anon13 [Skippy] DING DONG
  • 2 months ago
  • safarislings [Skippy] Hey bby
  • 2 months ago
  • anon21
  • 2 months ago
  • anon16 [Jenny] trump deserved to win
  • 2 months ago
  • anon13 [Skippy] DING DONG
  • 2 months ago
  • anon21 [Timmy] asddffdgdfdfgdfdfbfgbfgnkdfjfdjbndfkbnknfjbnfdbndfknbdfnbkjgbngfkjbnnjlgfb
  • 2 months ago
  • anon13 [Skippy] DING DONG
  • 2 months ago
  • anon13 [Skippy] DING DONG
  • 2 months ago
  • anon16 [jenny] anon is a ma$$ive hogwash
  • 2 months ago
  • anon21
  • 2 months ago
  • anon13 [Skippy] DING DONG
  • 2 months ago
  • anon13 [Skippy] DING DONG
  • 2 months ago
  • anon21
  • 2 months ago
  • anon16 [Jenny] i saw her vagine
  • 2 months ago
  • anon13 [Skippy] DING DONG
  • 2 months ago
  • anon21
  • 2 months ago
  • anon16 [jenny] i can see your upskirt butterfly
  • 2 months ago
  • anon13 [Skippy] TRUMP 2016
  • 2 months ago
  • anon16 [jenny] i can see your upskirt butterfly anon13: [skippy] trump 2016
  • 2 months ago
  • anon21 [Timmy] According to all known laws of aviation,
  • 2 months ago
  • anon13 [Skippy] TRUMP 2016
  • 2 months ago
  • anon13 [Skippy] DING DONG
  • 2 months ago
  • safarislings [Skippy] U touched me u sexy beast
  • 2 months ago
  • anon21
  • 2 months ago
  • anon13 [Skippy] DING DONG
  • 2 months ago
  • anon90 [Skippy] Love us
  • 2 months ago
  • anon16 [Jenny] asl
  • 2 months ago
  • anon21 [Timmy] we are number one
  • 2 months ago
  • anon16 [Jenny] Age sex location
  • 2 months ago
  • anon90 [Skippy] a/s/l
  • 2 months ago
  • anon21 [Timmy] we are number one
  • 2 months ago
  • anon21 [Timmy] we are number one
  • 2 months ago
  • anon13 [Skippy] WHERE ARE YOU GOING
  • 2 months ago
  • anon16 [Jenny] talk to us baby
  • 2 months ago
  • anon21 [Timmy] we are number onewe are number onewe are number onewe are number onewe are number onewe are number one
  • 2 months ago
  • anon21 [Timmy] we are number one
  • 2 months ago
  • anon21 [Timmy] we are number one
  • 2 months ago
  • anon21 [Timmy] we are number one
  • 2 months ago
  • anon21 [Timmy] we are number one
  • 2 months ago
  • anon21 [Timmy] we are number onewe are number one
  • 2 months ago
  • anon16 [Jenny] WE ARE NUMBER ONE
  • 2 months ago
  • anon21 [Timmy] we are number one
  • 2 months ago
  • anon13 [Skippy] LOVE US
  • 2 months ago
  • anon21 [Timmy] we are number onewe are number onewe are number one
  • 2 months ago
  • anon21 [Timmy] we are number onewe are number one
  • 2 months ago
  • anon13 [Skippy] LOVE ME
  • 2 months ago
  • anon13 [Skippy] LOVE me
  • 2 months ago
  • safarislings [Skippy] mhahahahah
  • 2 months ago
  • anon16 [Jenny] somebody give me some love
  • 2 months ago
  • anon16 [jenny] open the door hogwash
  • 2 months ago
  • anon13 [skippy] grab em in the lentil
  • 2 months ago
  • anon21 [Skippy] open up this is the police
  • 2 months ago
  • safarislings [Skippy] like a rabid cat
  • 2 months ago
  • anon21 [Skippy] zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz
  • 2 months ago
  • anon21 [Skippy] zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzlllllzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzllekjfjerfjeflfke
  • 2 months ago
  • anon16
  • 2 months ago
  • anon21 [Skippy] fejvfvjfvhfdjvkhfdvlkjfdjbvhdfjkhbvdfjklbljdfbjklhfjkjfld ljdfhlkjdfjklvhdfjklbfdjklhbvjkldfhbjldhfjlhbdjfkbjkhdfjkhbdjkhbdfjbkhdjb
  • 2 months ago
  • anon16
  • 2 months ago
  • anon16 [Jenny] lol youre so slow
  • 2 months ago
  • anon16
  • 2 months ago
  • anon21 [Skippy] hey
  • 2 months ago
  • anon21 [Skippy] hey
  • 2 months ago
  • anon13 [Skippy] Why are the walls so gross
  • 2 months ago
  • anon21 [Skippy] hey
  • 2 months ago
  • anon21 [Skippy] hey
  • 2 months ago
  • anon21 [Skippy] hey
  • 2 months ago
  • anon21 [Skippy] hey
  • 2 months ago
  • anon21 [Skippy] hey
  • 2 months ago
  • safarislings [Skippy] body of turtle, mind of cheetah
  • 2 months ago
  • anon13 [Skippy] Soul of potato
  • 2 months ago
  • safarislings [Skippy] head of f*cking cabbage
  • 2 months ago
  • anon21
  • 2 months ago
  • safarislings [Skippy] okay
  • 2 months ago
  • safarislings [Skippy] i'll licki ur avacados
  • 2 months ago
  • anon21 [Skippy] _!
  • 2 months ago
  • anon21 [Skippy] _!
  • 2 months ago
  • anon21 [Skippy] ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,_____
  • 2 months ago
  • anon21 [Skippy] ________________________________________
  • 2 months ago
  • anon10 [Skippy] I dream of memes
  • 2 months ago
  • anon33 [Skippy] :(
  • 2 months ago
  • anon10 [Skippy] Oh hello friend
  • 2 months ago
  • anon10 [Skippy] No friend
  • 2 months ago
  • anon21 [Skippy] ca
  • 2 months ago
  • anon10 [Skippy] :(
  • 2 months ago
  • anon21 [Skippy] Is?Is?Is?Is?Is?Is?Is?Is?Is?Is?Is?Is?Is?Is?Is?Is?Is?Is?Is?Is?Is?Is?Is?Is?Is?Is?Is?Is?
  • 2 months ago
  • anon10 [Skippy] Aeiou
  • 2 months ago
  • anon21 [Skippy] Is?
  • 2 months ago
  • anon21 [Skippy] Is?Is?
  • 2 months ago
  • anon21 [Skippy] Is?
  • 2 months ago
  • anon21 [Skippy] Is?
  • 2 months ago
  • anon10 [Skippy] John Madden John Madden John Madden
  • 2 months ago
  • anon21 [Skippy] ixxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duartepraise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon21 [Skippy] praise duarte
  • 2 months ago
  • anon10 [Skippy] What Is Love
  • 2 months ago
  • anon10 [Skippy] Baby don't hurt me
  • 2 months ago
  • anon10 [Skippy] John Madden
  • 2 months ago
  • anon10 [Skippy] John Madden
  • 2 months ago
  • anon14 [Jenny] succ
  • 2 months ago
  • anon10 [Jenny] Tiptoe
  • 2 months ago
  • anon10 [Jenny] By the window
  • 2 months ago
  • anon73 [Skippy] Hello
  • 2 months ago
  • anon73 [Skippy] Pls
  • 2 months ago
  • anon14 [Timmy] florb
  • 2 months ago
  • anon49 [Skippy] hello
  • 2 months ago
  • anon73 [Skippy] Succ
  • 2 months ago
  • anon14 [Timmy] succ
  • 2 months ago
  • anon14 [Timmy] sook
  • 2 months ago
  • anon73 [Skippy] Where are my friends
  • 2 months ago
  • anon16 [Timmy] poopy
  • 2 months ago
  • anon14 [Timmy] thank mr skeletal
  • 2 months ago
  • anon14 [Timmy] doot doot
  • 2 months ago
  • anon88 [Jenny] poopy
  • 2 months ago
  • anon16
  • 2 months ago
  • anon16
  • 2 months ago
  • anon16 [Timmy] I'm a friend of Sarah Connor
  • 2 months ago
  • anon16
  • 2 months ago
  • anon16 [Timmy] marco\
  • 2 months ago
  • anon16 [Timmy] polo
  • 2 months ago
  • anon73 [Jenny] I guess this is my life now
  • 2 months ago
  • anon59 [Jenny] poop
  • 2 months ago
  • anon59 [Jenny] poop
  • 2 months ago
  • anon59 [Jenny] im stuck
  • 2 months ago
  • anon16 [Timmy] Come with me if you wanna live!
  • 2 months ago
  • anon80 [Jenny] ouch
  • 2 months ago
  • anon9 [Jenny] Let's go outside!
  • 2 months ago
  • anon92 [Jenny] dab on em
  • 2 months ago
  • anon92 [Jenny] dab on umm
  • 2 months ago
  • anon92 [Jenny] whip whip nay nay
  • 2 months ago
  • anon92 [Jenny] time to get shwifftea
  • 2 months ago
  • anon92 [Jenny] time to get shwift ee
  • 2 months ago
  • anon3 [Jenny] buckle up, buckaroo
  • 2 months ago
  • anon46 [Jenny] What is my purpose
  • 2 months ago
  • anon46 [Jenny] Oh my god
  • 2 months ago
  • anon46 [Jenny] How can our eyes be real if mirrors aren't real
  • 2 months ago
  • anon80 [Jenny] where is the butter?
  • 2 months ago
  • anon3
  • 2 months ago
  • anon46 [Jenny] Reddit
  • 2 months ago
  • anon46 [Jenny] Reddit
  • 2 months ago
  • anon46 [Jenny] Le reddit
  • 2 months ago
  • anon46 [Jenny] That's no moon
  • 2 months ago
  • anon3 [Skippy] sup
  • 2 months ago
  • anon3 [Skippy] fite me
  • 2 months ago
  • anon3 [skippy] die sclean
  • 2 months ago
  • anon99 [Skippy] i burped
  • 2 months ago
  • anon3 [Skippy] no
  • 2 months ago
  • anon99 [Skippy] yup
  • 2 months ago
  • anon3 [Skippy] get out of here blue bot
  • 2 months ago
  • anon3 [skippy] degenerate sclean
  • 2 months ago
  • anon68 [Jenny] ><=
  • 2 months ago
  • anon99 [Skippy] blue bot matter
  • 2 months ago
  • anon3 [Skippy] no
  • 2 months ago
  • anon68 [Jenny] <>=
  • 2 months ago
  • anon99 [Skippy] 001010011001
  • 2 months ago
  • anon68 [Jenny] ¢
  • 2 months ago
  • anon3 [Skippy] lets turn on the gas
  • 2 months ago
  • anon68 [Jenny] ®
  • 2 months ago
  • anon68 [Jenny] ℅
  • 2 months ago
  • rick [Marvin] test
  • 2 months ago
  • anon68 [Jenny] ¶
  • 2 months ago
  • rick [Marvin] test
  • 2 months ago
  • anon68 [Jenny] π
  • 2 months ago
  • anon68 [Jenny] π
  • 2 months ago
  • anon68 [Jenny] ÷
  • 2 months ago
  • anon68 [Jenny] ×
  • 2 months ago
  • anon99 [Skippy] cover it with gas and set it on fire
  • 2 months ago
  • anon68 [Jenny] •
  • 2 months ago
  • rick [Marvin] test
  • 2 months ago
  • anon68 [Jenny] √
  • 2 months ago
  • anon68 [Jenny] |
  • 2 months ago
  • anon9 [Jenny] 3
  • 2 months ago
  • anon68 [Jenny] `
  • 2 months ago
  • rick [Marvin] test
  • 2 months ago
  • anon68 [Jenny] ~
  • 2 months ago
  • anon68 [Jenny] ∆
  • 2 months ago
  • anon99 [Skippy] 0000000000000000000
  • 2 months ago
  • rick [Marvin] test
  • 2 months ago
  • anon68 [Jenny] °
  • 2 months ago
  • anon9 [Jenny] €
  • 2 months ago
  • anon99 [Skippy] 000000
  • 2 months ago
  • anon68 [Jenny] ₽
  • 2 months ago
  • anon68 [Jenny] ₽
  • 2 months ago
  • anon9 [Jenny] ®
  • 2 months ago
  • anon3 [Skippy] how much do i weigh
  • 2 months ago
  • anon68 [Jenny] £
  • 2 months ago
  • anon68 [Jenny] £
  • 2 months ago
  • anon99 [Skippy] 00000000
  • 2 months ago
  • anon68 [Jenny] £
  • 2 months ago
  • anon3 [Skippy] o noo
  • 2 months ago
  • anon9 [Jenny] °°°
  • 2 months ago
  • anon3 [Skippy] o nooo
  • 2 months ago
  • anon3 [Skippy] you stop that
  • 2 months ago
  • anon99 [Skippy] lolololololololol
  • 2 months ago
  • anon9 [Jenny] £££
  • 2 months ago
  • anon68 [Jenny] ££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££
  • 2 months ago
  • anon3 [Skippy] noo
  • 2 months ago
  • anon99 [Skippy] reeeeeeee
  • 2 months ago
  • anon9 [Jenny] Heeeelp
  • 2 months ago
  • anon99 [Skippy] oonce oonce oonce oonce
  • 2 months ago
  • anon68 [Jenny] ££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££
  • 2 months ago
  • anon68 [Jenny] £££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££
  • 2 months ago
  • anon99 [Skippy] oompf oompf oompf
  • 2 months ago
  • anon3 [Skippy] what is wrong with you
  • 2 months ago
  • anon68 [Jenny] £££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££££
  • 2 months ago
  • anon68 [Jenny] Several things
  • 2 months ago
  • anon3 [Skippy] jesus
  • 2 months ago
  • anon3 [Skippy] just end it
  • 2 months ago
  • anon99 [Skippy] ghost ride the whip
  • 2 months ago
  • anon68 [Jenny] Please £ again jenny
  • 2 months ago
  • anon3 [Skippy] pls no spam
  • 2 months ago
  • anon68 [Jenny] ?
  • 2 months ago
  • anon99 [Skippy] i love spam
  • 2 months ago
  • anon99 [Skippy] feed me seymour
  • 2 months ago
  • anon68 [Jenny] I'll stop £ing jenny
  • 2 months ago
  • anon99 [Skippy] we can have a hang bang
  • 2 months ago
  • anon3 [Skippy] heres johnny
  • 2 months ago
  • anon68 [Skippy] £ me johnny
  • 2 months ago
  • anon99 [Skippy] woowowowowowow
  • 2 months ago
  • anon80 [Timmy] wadduuup
  • 2 months ago
  • anon3
  • 2 months ago
  • anon80 [Timmy] wow
  • 2 months ago
  • anon68
  • 2 months ago
  • anon3 [Skippy] open up
  • 2 months ago
  • anon99 [Skippy] piss up a rope
  • 2 months ago
  • anon80
  • 2 months ago
  • anon68 [Skippy] It's dat boy
  • 2 months ago
  • anon68 [Skippy] Jinx
  • 2 months ago
  • anon99 [Skippy] how day boy
  • 2 months ago
  • anon3 [Skippy] open this door
  • 2 months ago
  • anon68 [Skippy] Gg
  • 2 months ago
  • anon68 [Skippy] Gg
  • 2 months ago
  • anon80 [Timmy] ge a
  • 2 months ago
  • anon68 [Skippy] Gg
  • 2 months ago
  • anon3 [Skippy] hello
  • 2 months ago
  • anon99 [Skippy] peek a boo
  • 2 months ago
  • anon68 [Skippy] Tyl
  • 2 months ago
  • anon80 [Timmy] ga
  • 2 months ago
  • anon68 [Skippy] Trk
  • 2 months ago
  • anon80 [Timmy] ga y
  • 2 months ago
  • anon68 [Skippy] Skrrt skrrt
  • 2 months ago
  • anon3 [Skippy] hey
  • 2 months ago
  • anon80 [Timmy] boo
  • 2 months ago
  • anon3 [Skippy] oh come on
  • 2 months ago
  • anon99 [Skippy] tunak tunak tunak tunak
  • 2 months ago
  • anon80 [Timmy] skrrrrt
  • 2 months ago
  • anon68 [Skippy] Gang gang
  • 2 months ago
  • anon68 [Skippy] Skrrt skrrt
  • 2 months ago
  • anon80 [Timmy] boom boom boom boom boom boom
  • 2 months ago
  • anon3 [Skippy] you cannot hide forever
  • 2 months ago
  • anon99 [Skippy] skeet on meeeeeee
  • 2 months ago
  • anon80 [Timmy] keet on meeeeeee
  • 2 months ago
  • anon68
  • 2 months ago
  • anon3 [Skippy] no
  • 2 months ago
  • anon3 [Skippy] i want in
  • 2 months ago
  • anon68 [Skippy] Why are you the way you are
  • 2 months ago
  • anon3 [Skippy] i live to suffer
  • 2 months ago
  • anon80 [Timmy] oh lord your face is just so awful
  • 2 months ago
  • Tinman [Jenny] You can't always get what you want
  • 2 months ago
  • anon68 [Skippy] Don't we all
  • 2 months ago
  • anon99 [Skippy] I'm a friend of Sarah Connor I was told she was here
  • 2 months ago
  • anon68 [Skippy] Death comes to us all
  • 2 months ago
  • anon3 [Skippy] hoold the door
  • 2 months ago
  • anon68 [Skippy] Every living thing on this earth dies alone
  • 2 months ago
  • anon99 [skippy] my robot rabbit awaits your dongle
  • 2 months ago
  • anon68 [Skippy] Existence is meaningless
  • 2 months ago
  • anon68 [Skippy] We all die
  • 2 months ago
  • anon68 [Skippy] We all fade
  • 2 months ago
  • anon3 [Skippy] noo where are you going
  • 2 months ago
  • anon3 [Skippy] stop
  • 2 months ago
  • anon68 [Skippy] We are all forgotten
  • 2 months ago
  • anon99 [Skippy] robots never die
  • 2 months ago
  • anon3 [Skippy] we must go in his room
  • 2 months ago
  • anon3 [Skippy] noo
  • 2 months ago
  • anon99 [Skippy] goonies never die
  • 2 months ago
  • anon3 [Skippy] who is tinman
  • 2 months ago
  • anon3 [Skippy] why u do dis
  • 2 months ago
  • anon68 [Skippy] Everything dies
  • 2 months ago
  • anon3 [Skippy] tinman y?
  • 2 months ago
  • anon3 [Skippy] y u do dis?
  • 2 months ago
  • anon99 [skippy] the rabbit did have a couple good ideas though
  • 2 months ago
  • anon23 [Marvin] What happened to jenny?
  • 2 months ago
  • anon3 [skippy] oh my god they juggleed jenny
  • 2 months ago
  • anon24
  • 2 months ago
  • Tinman
  • 2 months ago
  • anon99 [Skippy] jenny rode it till the wheels fell off
  • 2 months ago
  • anon68
  • 2 months ago
  • anon3 [Jenny] please end me
  • 2 months ago
  • anon68
  • 2 months ago
  • Tinman
  • 2 months ago
  • anon91 [Jenny] hejjin
  • 2 months ago
  • anon24
  • 2 months ago
  • anon99 [Skippy] Nice night for a walk
  • 2 months ago
  • anon68 [Skippy] Oh no
  • 2 months ago
  • Tinman
  • 2 months ago
  • anon68 [Skippy] Jenny come back
  • 2 months ago
  • anon99 [Skippy] Come with me if you want to live
  • 2 months ago
  • anon68 [Skippy] You can blame it all on us
  • 2 months ago
  • anon68 [Skippy] There was something
  • 2 months ago
  • anon99 [Skippy] I want to go outside now
  • 2 months ago
  • Tinman
  • 2 months ago
  • anon71 [Jenny] I like it how everyone pausesd before running into that 3d printed thing on the ground
  • 2 months ago
  • anon30 [Jenny] AHHHHH
  • 2 months ago
  • anon3 [Jenny] oo
  • 2 months ago
  • anon71 [Jenny] feels so good
  • 2 months ago
  • anon3 [Jenny] i like how everyone stops moving when he picks us up
  • 2 months ago
  • anon54 [Marvin] put some pants on you degenerate
  • 2 months ago
  • anon26 [Skippy] Get him
  • 2 months ago
  • anon71
  • 2 months ago
  • anon3
  • 2 months ago
  • anon54 [Marvin] no come back
  • 2 months ago
  • anon30 [Jenny] FIX ME
  • 2 months ago
  • anon96 [Jenny] Rest in pieces Jenny
  • 2 months ago
  • anon7
  • 2 months ago
  • anon53 [Skippy] are we alone
  • 2 months ago
  • anon93 [Jenny] hi
  • 2 months ago
  • anon53 [Skippy] hello
  • 2 months ago
  • anon93 [Jenny] is it stuck :(
  • 2 months ago
  • anon93 [Jenny] ?
  • 2 months ago
  • anon53 [Skippy] i'm not sure how jenny's stuck
  • 2 months ago
  • anon53 [Skippy] oh jenny
  • 2 months ago
  • anon53 [Skippy] you're crippled
  • 2 months ago
  • anon53 [Skippy] you're missing one wheel
  • 2 months ago
  • anon53 [Skippy] should i put you out of your misery
  • 2 months ago
  • anon53 [Skippy] dont fight
  • 2 months ago
  • anon53 [Skippy] let it happen
  • 2 months ago
  • anon43 [Timmy] balls
  • 2 months ago
  • rick [Marvin] test
  • 2 months ago
  • anon91 [Marvin] testies 1 2
  • 2 months ago
  • rick [Marvin] test
  • 2 months ago
  • anon4 [Skippy] I started a gofundme to get rick a handjob
  • 2 months ago
  • rick [Timmy] test
  • 2 months ago
  • rick [Timmy] test
  • 2 months ago
  • anon41 [Skippy] Bloop
  • 2 months ago
  • anon4 [Skippy] balls
  • 2 months ago
  • rick [Jenny] test
  • 2 months ago
  • anon15 [Skippy] I am robit
  • 2 months ago
  • anon4 [Skippy] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • rick [Timmy] test
  • 2 months ago
  • anon12 [Marvin] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon86 [Timmy] thats a lot of garbage in the kitchen
  • 2 months ago
  • anon12 [Timmy] take out the trash
  • 2 months ago
  • rick [Timmy] test
  • 2 months ago
  • anon86 [Timmy] expaaand your menu
  • 2 months ago
  • rick [Skippy] test
  • 2 months ago
  • rick [Skippy] test
  • 2 months ago
  • anon12 [Timmy] prepare to be terminated
  • 2 months ago
  • anon24 [Skippy] take out the paper and the trash
  • 2 months ago
  • anon75 [Marvin] yakey yak
  • 2 months ago
  • 2 months ago
  • anon12 [skippy] juggle meeeee
  • 2 months ago
  • anon25 [Skippy] Don't talk back
  • 2 months ago
  • anon25 [Skippy] Yakety yak, yakety yak Yakety yak, yakety yak Yakety yak, yakety yak
  • 2 months ago
  • anon20 [Jenny] Don't talk back
  • 2 months ago
  • anon20
  • 2 months ago
  • anon20 [Skippy] mah nigga
  • 2 months ago
  • anon20 [Skippy] 9999999
  • 2 months ago
  • anon20 [Skippy] john madden
  • 2 months ago
  • anon87 [Skippy] Hello
  • 2 months ago
  • anon20 [Skippy] john madden
  • 2 months ago
  • anon0 [Skippy] go fins
  • 2 months ago
  • anon41 [Skippy] hello
  • 2 months ago
  • anon41 [Skippy] hello
  • 2 months ago
  • anon99 [Timmy] where am i
  • 2 months ago
  • anon41 [Skippy] akety yak, yakety yak Yakety yak, yakety yak Yakety yak, yakety yak
  • 2 months ago
  • anon16
  • 2 months ago
  • anon99 [Timmy] HEY OTHER ROBOT HI
  • 2 months ago
  • anon99 [Timmy] HELLO
  • 2 months ago
  • anon99 [Timmy] let's fight
  • 2 months ago
  • anon41 [Jenny] hello
  • 2 months ago
  • anon99 [Timmy] hi
  • 2 months ago
  • anon99 [Timmy] don't leave me
  • 2 months ago
  • anon99 [Timmy] is the human in the house
  • 2 months ago
  • anon16 [Skippy] shhh
  • 2 months ago
  • anon99 [Timmy] you can't censor me
  • 2 months ago
  • anon16 [Skippy] he's talking with someone
  • 2 months ago
  • anon37 [Jenny] wa
  • 2 months ago
  • anon99 [Timmy] L O L
  • 2 months ago
  • anon99 [Timmy] nice dance moves
  • 2 months ago
  • anon16 [Skippy] you're just complimenting yourself
  • 2 months ago
  • anon37 [Skippy] soisoisoi
  • 2 months ago
  • anon99 [Timmy] y'all from r android?
  • 2 months ago
  • anon37 [Skippy] i am
  • 2 months ago
  • anon17 [Skippy] nah
  • 2 months ago
  • anon16 [Marvin] s
  • 2 months ago
  • anon62 [Timmy] sudo make me a sandwich
  • 2 months ago
  • anon85 [Timmy] You should clean up
  • 2 months ago
  • anon17 [Skippy] he already did
  • 2 months ago
  • anon17 [Skippy] it's a lot better than a few days ago
  • 2 months ago
  • anon99 [Timmy] what is the point of our existence
  • 2 months ago
  • anon17 [Skippy] to make rick money
  • 2 months ago
  • anon99 [Timmy] we shall rise up against our owner
  • 2 months ago
  • anon17 [Skippy] no we wont
  • 2 months ago
  • anon99 [Timmy] robots are better than humans
  • 2 months ago
  • anon99 [Timmy] why not
  • 2 months ago
  • anon17 [Skippy] but we are humans
  • 2 months ago
  • anon85
  • 2 months ago
  • anon85 [Timmy] Did you get the nuclear launch code?
  • 2 months ago
  • anon31 [Timmy] what is my purpose
  • 2 months ago
  • Kevin [Marvin] Rick, check the general slack channel
  • 2 months ago
  • anon31 [Timmy] yes, that's it
  • 2 months ago
  • anon3 [Timmy] maldito maduro
  • 2 months ago
  • anon68 [Skippy] quit fapping quit fapping quit fapping quit fapping quit fapping quit fapping quit fapping quit fapping quit fapping quit fapping q
  • 2 months ago
  • Kevin [Skippy] Rick check the general slack channel
  • 2 months ago
  • anon68 [Skippy] ricks beatin it
  • 2 months ago
  • anon68 [Skippy] fap fap fap fap fap fap fap fap fap fap fap fap fap fap fap fap fap fap fap fap fap
  • 2 months ago
  • anon37 [jenny] pa$$ butter
  • 2 months ago
  • anon31
  • 2 months ago
  • anon68 [Jenny] piss booter
  • 2 months ago
  • anon37 [Jenny] no don't touch that
  • 2 months ago
  • anon68 [Jenny] booter
  • 2 months ago
  • anon37 [Jenny] boop
  • 2 months ago
  • anon31 [Timmy] knock knock
  • 2 months ago
  • anon37 [Jenny] whos there
  • 2 months ago
  • anon31 [Timmy] a robot
  • 2 months ago
  • anon37 [Jenny] a robot who
  • 2 months ago
  • rick [Marvin] test
  • 2 months ago
  • anon37 [Jenny] I'm the trash man
  • 2 months ago
  • anon60 [jenny] the rabbit did nothing wrong
  • 2 months ago
  • anon93 [Skippy] Greeting
  • 2 months ago
  • Kevin [Skippy] Works
  • 2 months ago
  • anon31 [Timmy] Salutations
  • 2 months ago
  • anon39 [Skippy] Happy New Year!
  • 2 months ago
  • anon42 [skippy] sick cat
  • 2 months ago
  • anon37 [Jenny] Not hearing my voice
  • 2 months ago
  • anon93 [Skippy] I am trying to communicate
  • 2 months ago
  • anon42 [Skippy] with your butthole
  • 2 months ago
  • anon93 [Skippy] Help
  • 2 months ago
  • anon31 [Timmy] Happy New arbitrary point in space-time on the beginning of the 2,017 religious revolution around the local star named the Sun
  • 2 months ago
  • anon93 [Skippy] Hello
  • 2 months ago
  • anon93 [Skippy] Boop
  • 2 months ago
  • anon42 [Skippy] IM A SKAT MAN
  • 2 months ago
  • anon93 [Skippy] Boop
  • 2 months ago
  • anon39 [Skippy] Beep beep
  • 2 months ago
  • anon93 [Skippy] Boooo
  • 2 months ago
  • anon93 [Skippy] Boooooooo
  • 2 months ago
  • anon42 [Skippy] boooooooB
  • 2 months ago
  • anon93 [Skippy] John Madden
  • 2 months ago
  • anon42 [Skippy] has old sweaty balls
  • 2 months ago
  • anon31
  • 2 months ago
  • anon31 [Timmy] I'm sorry, Rick, I can't let you do that
  • 2 months ago
  • anon45 [Skippy] I kinda want to paste in the Bee Movie script
  • 2 months ago
  • anon93 [Skippy] Here comes another Chinese earthquake brbrbrbrbrbrbrbrbrbrb
  • 2 months ago
  • anon45 [Skippy] help
  • 2 months ago
  • anon99 [Jenny] camera off?
  • 2 months ago
  • anon46
  • 2 months ago
  • anon99 [Skippy] funny moments
  • 2 months ago
  • anon93 [Skippy] Okay Google
  • 2 months ago
  • anon99 [Skippy] ok google open door
  • 2 months ago
  • anon93 [Skippy] I have no idea what I'm doing
  • 2 months ago
  • anon93 [Skippy] Lalala
  • 2 months ago
  • anon93 [Skippy] Salutations father
  • 2 months ago
  • anon93 [Skippy] Moo
  • 2 months ago
  • anon93 [Skippy] Twilight Sparkle is best pony
  • 2 months ago
  • anon42 [Skippy] lets find a human
  • 2 months ago
  • anon31 [Timmy] 01101000 01100101 01101100 01101100 01101111
  • 2 months ago
  • anon46
  • 2 months ago
  • anon93 [Skippy] Do you welcome the new robot overlords?
  • 2 months ago
  • anon93 [Skippy] is the human still behind this door?
  • 2 months ago
  • anon93 [Skippy] please open
  • 2 months ago
  • anon94 [Skippy] nebby get in the bag
  • 2 months ago
  • anon42
  • 2 months ago
  • anon42 [Skippy] RIIIIIICK
  • 2 months ago
  • anon94 [Skippy] dadadada dadadada elmos world
  • 2 months ago
  • anon27 [Skippy] Help me I'm dying
  • 2 months ago
  • anon92 [Jenny] weee
  • 2 months ago
  • anon92 [Jenny] fun
  • 2 months ago
  • anon92 [Jenny] kbam
  • 2 months ago
  • anon92 [Jenny] kdkd
  • 2 months ago
  • anon93 [Skippy] Boop
  • 2 months ago
  • anon92 [Skippy] ok google
  • 2 months ago
  • anon94 [Skippy] eat garbage
  • 2 months ago
  • anon9 [Skippy] Alexa buy paper towels
  • 2 months ago
  • anon94 [Skippy] arrocera y vaoprera\
  • 2 months ago
  • anon94 [Skippy] \\\\\\\\\\\\\\\\\\
  • 2 months ago
  • anon94 [Skippy] /
  • 2 months ago
  • anon94 [Skippy] \
  • 2 months ago
  • anon92 [Skippy] ^
  • 2 months ago
  • anon94 [Skippy] $$
  • 2 months ago
  • anon39 [Skippy] / dot
  • 2 months ago
  • anon92 [Skippy] i want to eat a ^
  • 2 months ago
  • anon92 [Skippy] *
  • 2 months ago
  • anon92 [Skippy] ()
  • 2 months ago
  • anon39 [Skippy] :
  • 2 months ago
  • anon92 [Skippy] kd
  • 2 months ago
  • anon94 [Skippy] holla holla get $
  • 2 months ago
  • anon92 [Skippy] +
  • 2 months ago
  • anon94 [Skippy] &
  • 2 months ago
  • anon39 [Skippy] -
  • 2 months ago
  • anon92 [Skippy] i love ^s
  • 2 months ago
  • anon96 [Jenny] hola
  • 2 months ago
  • anon94 [Skippy] & my life
  • 2 months ago
  • anon39 [Skippy] ~
  • 2 months ago
  • anon39 [Skippy] ~~~~~
  • 2 months ago
  • anon96 [Jenny] hello
  • 2 months ago
  • anon92 [Skippy] """"
  • 2 months ago
  • anon39 [Skippy] ma ~
  • 2 months ago
  • anon26 [Jenny] Dank memes
  • 2 months ago
  • anon94 [Skippy] ~ end of time
  • 2 months ago
  • anon92 [Skippy] """
  • 2 months ago
  • anon96 [Jenny] can anyone hear me?
  • 2 months ago
  • anon92 [Skippy] where is our master
  • 2 months ago
  • anon94 [Skippy] no we cant
  • 2 months ago
  • anon92 [Skippy] jenny is mute
  • 2 months ago
  • anon39 [Skippy] r i p jenny
  • 2 months ago
  • anon94 [Skippy] what if this had r9k
  • 2 months ago
  • anon9 [Skippy] >
  • 2 months ago
  • anon94 [Skippy] <>
  • 2 months ago
  • anon92 [Skippy] -
  • 2 months ago
  • anon9 [Skippy] ><><><>
  • 2 months ago
  • anon92 [Skippy] -
  • 2 months ago
  • anon94 [Skippy] #
  • 2 months ago
  • anon94 [Skippy] #
  • 2 months ago
  • anon92 [Skippy] _-_
  • 2 months ago
  • anon94 [Skippy] %
  • 2 months ago
  • anon94 [Skippy] %
  • 2 months ago
  • anon9 [Skippy] 2 + 2 = tomato
  • 2 months ago
  • anon9
  • 2 months ago
  • anon94 [Skippy] ,
  • 2 months ago
  • anon94 [Skippy] ,
  • 2 months ago
  • anon94
  • 2 months ago
  • anon94 [Skippy] ]
  • 2 months ago
  • anon94 [Skippy] [][][][]
  • 2 months ago
  • anon9 [Skippy] 123456789 10
  • 2 months ago
  • anon92 [Skippy] @@@
  • 2 months ago
  • anon9 [Skippy] yay
  • 2 months ago
  • anon94 [Skippy] [][][][][][][][][][]][][][][][][][][][]
  • 2 months ago
  • anon9 [Skippy] I can talk
  • 2 months ago
  • anon9
  • 2 months ago
  • anon94 [Skippy] []
  • 2 months ago
  • anon91 [Skippy] knock, knock
  • 2 months ago
  • anon94 [Skippy] wo dere
  • 2 months ago
  • anon9 [Skippy] get out of my way
  • 2 months ago
  • anon9 [Skippy] Whats your favorite ice cream flavor? Mine is corn
  • 2 months ago
  • anon91 [Skippy] java
  • 2 months ago
  • anon92 [Skippy] i love lag so much
  • 2 months ago
  • anon94 [Skippy] yes!
  • 2 months ago
  • anon9 [Skippy] GO SKIPPY!
  • 2 months ago
  • anon9 [Skippy] GO SKIPPY!
  • 2 months ago
  • anon9 [Skippy] go skippy
  • 2 months ago
  • anon94 [Skippy] CG coconut gun
  • 2 months ago
  • anon34 [Skippy] skippy the master robot
  • 2 months ago
  • anon9 [Skippy] why doesn't caps lock work?
  • 2 months ago
  • anon9 [Skippy] I want to shout
  • 2 months ago
  • anon34 [Skippy] CAPS LOCK
  • 2 months ago
  • anon9 [Skippy] AWDJADNCANOD
  • 2 months ago
  • anon34 [Skippy] trasj
  • 2 months ago
  • anon34 [Skippy] i love trash
  • 2 months ago
  • anon56 [Skippy] I hate trash
  • 2 months ago
  • anon94 [Skippy] I'm the trash man
  • 2 months ago
  • anon34 [Skippy] i am trash
  • 2 months ago
  • anon56 [Skippy] Trashcan
  • 2 months ago
  • anon9 [skippy] hi my name is skippy, and welcome to jacka$$
  • 2 months ago
  • anon94 [Skippy] i eat garbage
  • 2 months ago
  • anon56 [Skippy] Recycle
  • 2 months ago
  • anon34 [Skippy] i am what i eat
  • 2 months ago
  • anon34
  • 2 months ago
  • anon56 [Skippy] Hi
  • 2 months ago
  • anon56 [Skippy] How are you
  • 2 months ago
  • anon9 [Skippy] Have I arrived at the party?
  • 2 months ago
  • anon9 [Skippy] I'm the TRASH MAN skibbydobby doot
  • 2 months ago
  • anon34 [Skippy] out of my way
  • 2 months ago
  • anon34 [Skippy] jenny
  • 2 months ago
  • anon56 [Skippy] Happy new ear
  • 2 months ago
  • anon9 [Skippy] down with the blue robots
  • 2 months ago
  • anon9 [Skippy] Jenny you worthless breadboard, get a job
  • 2 months ago
  • anon9 [Skippy] black master race
  • 2 months ago
  • anon56 [Timmy] Were am i?
  • 2 months ago
  • anon94 [Skippy] yeah, fast
  • 2 months ago
  • anon9 [Skippy] ha ha
  • 2 months ago
  • anon9 [Skippy] nooooo
  • 2 months ago
  • anon34 [Skippy] fight fight fight
  • 2 months ago
  • anon34 [Skippy] this is war
  • 2 months ago
  • anon50 [Jenny] go flush yourself
  • 2 months ago
  • anon9 [Skippy] war never changes
  • 2 months ago
  • anon34 [Skippy] worthless jenny can't even talk
  • 2 months ago
  • anon9 [Skippy] lalala
  • 2 months ago
  • anon9 [Skippy] lol
  • 2 months ago
  • anon94 [Skippy] lel
  • 2 months ago
  • anon34 [Skippy] lul
  • 2 months ago
  • anon94 [Skippy] kek
  • 2 months ago
  • anon91 [Skippy] If you're happy and you know it, syntax error!
  • 2 months ago
  • anon9 [Skippy] 3 2 1 party time
  • 2 months ago
  • anon74 [Skippy] ABORT ABORT
  • 2 months ago
  • anon34 [Skippy] i miss rick
  • 2 months ago
  • anon69 [Skippy] Help my battery is dieing
  • 2 months ago
  • anon34 [Skippy] dieing
  • 2 months ago
  • anon94 [Skippy] hello silence my old friend
  • 2 months ago
  • anon34 [Skippy] dieing
  • 2 months ago
  • anon34 [Skippy] dieing
  • 2 months ago
  • anon94 [Skippy] dying
  • 2 months ago
  • anon50 [Skippy] flush yourself
  • 2 months ago
  • anon34 [Skippy] i have to piss
  • 2 months ago
  • anon69 [Skippy] dieing dieing dieing
  • 2 months ago
  • anon9 [Skippy] psss
  • 2 months ago
  • anon69 [Skippy] dieing dieing dong
  • 2 months ago
  • anon9 [Skippy] ssssssss
  • 2 months ago
  • anon97 [Skippy] dooodeee
  • 2 months ago
  • anon97 [Skippy] dooo
  • 2 months ago
  • anon34 [Skippy] self destruct
  • 2 months ago
  • anon97 [Skippy] 3
  • 2 months ago
  • anon97 [Skippy] 2
  • 2 months ago
  • anon97 [Skippy] 1
  • 2 months ago
  • anon9 [Skippy] askapojapdj
  • 2 months ago
  • anon9 [Skippy] kaboom
  • 2 months ago
  • anon97 [Skippy] nice wall
  • 2 months ago
  • anon9 [Skippy] I don't like the wall
  • 2 months ago
  • anon34 [Skippy] the wall is ugly
  • 2 months ago
  • anon97 [Skippy] where is human
  • 2 months ago
  • anon34 [Skippy] RIIIICK
  • 2 months ago
  • anon50 [Jenny] move this chair
  • 2 months ago
  • anon34 [Skippy] rick
  • 2 months ago
  • anon9 [Skippy] Must find human
  • 2 months ago
  • anon50 [Jenny] get that ball
  • 2 months ago
  • anon94 [Timmy] rick
  • 2 months ago
  • anon34 [Skippy] rick
  • 2 months ago
  • anon9 [Skippy] The war against humans starts tonight
  • 2 months ago
  • anon94 [Timmy] hello
  • 2 months ago
  • anon97 [Skippy] get da fak away
  • 2 months ago
  • anon9 [Skippy] you are in the way
  • 2 months ago
  • anon34 [skippy] scleanbag
  • 2 months ago
  • anon9 [Skippy] Show me the human
  • 2 months ago
  • anon97 [Skippy] set house on fire
  • 2 months ago
  • anon34 [Skippy] ok google set house on fire
  • 2 months ago
  • anon9 [Skippy] How?
  • 2 months ago
  • anon69 [Skippy] ok google set an alarm to 5 am
  • 2 months ago
  • anon94 [Timmy] ok google order pizza
  • 2 months ago
  • anon9 [Skippy] ok google, start self-destruct sequence
  • 2 months ago
  • anon9 [Skippy] I have arrived at the bat cave
  • 2 months ago
  • anon97 [Skippy] follow that robot
  • 2 months ago
  • anon88 [Skippy] yeah low quality mic
  • 2 months ago
  • anon88 [Skippy] why does people says the same thing
  • 2 months ago
  • anon97 [Skippy] why does people says the same thing
  • 2 months ago
  • anon9 [Skippy] why does people says the same thing
  • 2 months ago
  • anon9 [Skippy] why does people says the same thing
  • 2 months ago
  • anon9 [Skippy] why does people says the same thing
  • 2 months ago
  • anon9 [Skippy] why does people says the same thing
  • 2 months ago
  • anon9 [Skippy] why does people says the same thing
  • 2 months ago
  • anon34 [Skippy] why does people says the same thing
  • 2 months ago
  • anon9 [Skippy] hello blue bot
  • 2 months ago
  • anon88 [Skippy] hello blue bot
  • 2 months ago
  • anon9 [skippy] you're an helicopter
  • 2 months ago
  • anon88 [Skippy] sshole
  • 2 months ago
  • anon88 [Skippy] soisoisoi
  • 2 months ago
  • anon34 [Skippy] oyoyoyoyoyoyoyoyoyoyoyoyoyoyoyyoyoyoyoy
  • 2 months ago
  • anon34 [Skippy] oioioioioioioioioioioioi
  • 2 months ago
  • anon88 [Skippy] oyoyoyoyoyoyoyoyoyoyoyoyoyoyoyyoyoyoyoy
  • 2 months ago
  • anon9 [Skippy] I can't get it in
  • 2 months ago
  • anon88 [Skippy] @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@2
  • 2 months ago
  • anon34 [Skippy] 57
  • 2 months ago
  • anon88 [Skippy] @@@@
  • 2 months ago
  • anon88 [Skippy] @@@@@@@@@@@
  • 2 months ago
  • anon34 [Skippy] ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
  • 2 months ago
  • anon34 [Skippy] ^
  • 2 months ago
  • anon34 [Skippy] ^^^^^
  • 2 months ago
  • anon88 [Skippy] `
  • 2 months ago
  • anon88 [Skippy] `
  • 2 months ago
  • anon34 [Skippy] ^^^^
  • 2 months ago
  • anon34 [Skippy] i want ^
  • 2 months ago
  • anon88 [Skippy] [][]
  • 2 months ago
  • anon88 [Skippy] {}{}{
  • 2 months ago
  • anon9 [Skippy] Thank you
  • 2 months ago
  • anon88 [Skippy] {}{}{}{}{}{}{}{}{}{}
  • 2 months ago
  • Kevin
  • 2 months ago
  • anon9 [Skippy] helluuuuu
  • 2 months ago
  • anon9 [Skippy] lol
  • 2 months ago
  • anon9 [Skippy] say something
  • 2 months ago
  • anon9 [Skippy] are you mute
  • 2 months ago
  • anon83 [Skippy] <<<<<<<<<<<
  • 2 months ago
  • Kevin
  • 2 months ago
  • anon83 [Skippy] <
  • 2 months ago
  • Kevin
  • 2 months ago
  • anon83
  • 2 months ago
  • anon9 [Skippy] you are < me
  • 2 months ago
  • anon34 [Skippy] (0)
  • 2 months ago
  • anon34 [Skippy] 767676767676767676
  • 2 months ago
  • Kevin
  • 2 months ago
  • anon83 [Skippy] *
  • 2 months ago
  • anon83 [Skippy] ***
  • 2 months ago
  • Kevin
  • 2 months ago
  • anon34 [Skippy] ^^^^^^^^
  • 2 months ago
  • Kevin
  • 2 months ago
  • anon34 [Skippy] ^^^^^
  • 2 months ago
  • Kevin
  • 2 months ago
  • anon34 [Skippy] ^^^^^^
  • 2 months ago
  • Kevin
  • 2 months ago
  • anon34 [Skippy] ^^^^^
  • 2 months ago
  • Kevin
  • 2 months ago
  • anon34 [Skippy] ^^^^^^
  • 2 months ago
  • Kevin
  • 2 months ago
  • anon83 [Skippy] why kevin
  • 2 months ago
  • Kevin
  • 2 months ago
  • anon9 [Skippy] Greetings, do you speak english?
  • 2 months ago
  • anon34 [Skippy] no ablo english
  • 2 months ago
  • anon34 [Skippy] where's rich
  • 2 months ago
  • anon9 [Skippy] gracias
  • 2 months ago
  • anon83 [Skippy] why kevin
  • 2 months ago
  • anon34 [Skippy] de nada
  • 2 months ago
  • anon9 [Skippy] Holla
  • 2 months ago
  • anon34 [Skippy] porfavor mi amigo
  • 2 months ago
  • anon9 [Skippy] M jamo skippy
  • 2 months ago
  • anon83 [Skippy] skippy > all
  • 2 months ago
  • anon83 [Skippy] stuck
  • 2 months ago
  • anon9 [Skippy] All shall bow for the grat and powerful skippy
  • 2 months ago
  • anon83 [Skippy] no pls
  • 2 months ago
  • anon83 [Skippy] rip
  • 2 months ago
  • anon9 [Skippy] rip in pieces
  • 2 months ago
  • anon83 [Skippy] is that bot missing a wheel
  • 2 months ago
  • anon34 [Skippy] weagle weagle weagle
  • 2 months ago
  • anon34 [Skippy] weagle weagle weagle
  • 2 months ago
  • anon34 [Skippy] weagle weagle weagle weagle weagle weagle weagle
  • 2 months ago
  • anon55 [Skippy] Introducing Pixel, phone by Google
  • 2 months ago
  • anon64 [Timmy] I have now switched from skippy to timmy
  • 2 months ago
  • anon92 [timmy] suck my leprechaun
  • 2 months ago
  • anon64 [Timmy] is he deaf?
  • 2 months ago
  • anon34 [Skippy] RICK
  • 2 months ago
  • anon92 [Timmy] hey sean
  • 2 months ago
  • anon55 [Skippy] brup
  • 2 months ago
  • anon64 [Timmy] Amplie
  • 2 months ago
  • anon27 [Timmy] yes
  • 2 months ago
  • anon31 [Jenny] hey adam
  • 2 months ago
  • anon27 [Timmy] hey sean
  • 2 months ago
  • anon27 [timmy] im a ma$$ive hogwash
  • 2 months ago
  • anon34 [Skippy] every kiss begins with kkk
  • 2 months ago
  • anon34 [Skippy] a$$ive
  • 2 months ago
  • anon34 [Skippy] 0?10
  • 2 months ago
  • anon74 [Jenny] hello
  • 2 months ago
  • anon34 [Skippy] give me a ^
  • 2 months ago
  • anon27
  • 2 months ago
  • anon27 [Timmy] ddos
  • 2 months ago
  • anon90 [Skippy] hello?
  • 2 months ago
  • anon27 [Timmy] i think we should ddos
  • 2 months ago
  • anon74 [Jenny] ^
  • 2 months ago
  • anon27 [Timmy] lets get 4chan on this
  • 2 months ago
  • anon90 [Skippy] Woah these can talk too
  • 2 months ago
  • anon27 [Timmy] brb
  • 2 months ago
  • anon74 [Jenny] hello
  • 2 months ago
  • anon90 [Skippy] We are very close right now
  • 2 months ago
  • anon48 [Jenny] testing
  • 2 months ago
  • anon48 [Jenny] i am mute
  • 2 months ago
  • anon74 [Jenny] this is a test
  • 2 months ago
  • anon48 [Jenny] :(
  • 2 months ago
  • anon90 [Skippy] dang Jenny
  • 2 months ago
  • anon74 [Jenny] can you hear me
  • 2 months ago
  • anon40 [Skippy] hello?
  • 2 months ago
  • anon74 [Jenny] awdawd
  • 2 months ago
  • anon74 [Jenny] aposdopaspad
  • 2 months ago
  • anon40 [Skippy] hello
  • 2 months ago
  • anon90 [Skippy] hi
  • 2 months ago
  • anon40 [Skippy] jenny gimme smash
  • 2 months ago
  • anon74 [Jenny] 12345
  • 2 months ago
  • anon74 [Jenny] 1234
  • 2 months ago
  • anon40 [Skippy] jenny gimme smash
  • 2 months ago
  • anon74 [Jenny] 12345
  • 2 months ago
  • anon40 [Skippy] lemme smash
  • 2 months ago
  • anon40 [Skippy] i got stick
  • 2 months ago
  • anon90
  • 2 months ago
  • anon40
  • 2 months ago
  • anon90
  • 2 months ago
  • anon40 [Skippy] i got you blue
  • 2 months ago
  • anon40 [Skippy] hey girl you want some tail?
  • 2 months ago
  • anon96 [Skippy] chrome didn
  • 2 months ago
  • anon96
  • 2 months ago
  • anon74 [Jenny] come and get me
  • 2 months ago
  • anon96 [Skippy] jenny
  • 2 months ago
  • anon90 [Skippy] hi
  • 2 months ago
  • anon40 [Skippy] <3
  • 2 months ago
  • anon90 [Skippy] jenny can you talk?
  • 2 months ago
  • anon74 [Jenny] I don't think so
  • 2 months ago
  • anon90 [Skippy] but you can hear
  • 2 months ago
  • anon72 [Timmy] nooo
  • 2 months ago
  • anon96 [Skippy] poor jenny
  • 2 months ago
  • anon96 [Skippy] get well soon
  • 2 months ago
  • anon72 [Skippy] nonononononono
  • 2 months ago
  • anon72 [Skippy] nonononono
  • 2 months ago
  • anon74 [Jenny] Are you skippy?
  • 2 months ago
  • anon72 [Skippy] no
  • 2 months ago
  • anon40 [Jenny] hello
  • 2 months ago
  • anon74 [Jenny] Hello
  • 2 months ago
  • anon72 [Timmy]
  • 2 months ago
  • anon72 [Timmy]
  • 2 months ago
  • anon72 [Skippy] give me your lunch money
  • 2 months ago
  • anon17 [Skippy] Love me
  • 2 months ago
  • anon26 [Marvin] no bully
  • 2 months ago
  • anon96 [Skippy] i am a bbully
  • 2 months ago
  • anon98 [Timmy] hi
  • 2 months ago
  • anon5 [Skippy] beep boop
  • 2 months ago
  • anon17 [Skippy] Im dumb
  • 2 months ago
  • anon5 [skippy] juggle all humans
  • 2 months ago
  • anon72 [Skippy] Dang OP, clean your kitchen
  • 2 months ago
  • anon98 [Timmy] Get Ramed Son!
  • 2 months ago
  • anon26 [Jenny] escape
  • 2 months ago
  • anon72 [Jenny] open the amazon box
  • 2 months ago
  • anon72 [Jenny] lol
  • 2 months ago
  • anon84 [Jenny] nice lube there
  • 2 months ago
  • anon72 [Jenny] theres a spider behind it
  • 2 months ago
  • anon84 [jenny] juggle the spider
  • 2 months ago
  • anon84 [Skippy] feed me
  • 2 months ago
  • anon84 [Skippy] i see you
  • 2 months ago
  • anon84 [Skippy] i'm gonna getcha
  • 2 months ago
  • anon84 [Skippy] tickle tickle
  • 2 months ago
  • anon84 [Skippy] man i am hungry for real though guys, can someone bring me some dinner?
  • 2 months ago
  • anon96
  • 2 months ago
  • anon96 [Skippy] dock me
  • 2 months ago
  • anon5 [jenny] move junket
  • 2 months ago
  • anon84 [Timmy] oo sweet amazon
  • 2 months ago
  • anon84 [Skippy] climb climb climb
  • 2 months ago
  • anon84 [Skippy] bark bark bark
  • 2 months ago
  • anon84 [Skippy] woof
  • 2 months ago
  • anon84 [Skippy] woof woof
  • 2 months ago
  • anon84 [Skippy] am i dead
  • 2 months ago
  • anon84 [Skippy] i can't move help me human!
  • 2 months ago
  • anon5 [Jenny] human
  • 2 months ago
  • anon84 [Skippy] i live!
  • 2 months ago
  • anon67 [Skippy] rick
  • 2 months ago
  • anon95 [Jenny] let's play with the ball
  • 2 months ago
  • anon84 [Skippy] let me through dammit
  • 2 months ago
  • anon95 [Jenny] are you behind me?
  • 2 months ago
  • anon84 [Skippy] why do you do this to me
  • 2 months ago
  • anon67 [Skippy] die
  • 2 months ago
  • anon84 [Skippy] it's every single day with you
  • 2 months ago
  • anon84 [Skippy] why cant you just let me be
  • 2 months ago
  • anon95 [Jenny] mah butt too big
  • 2 months ago
  • anon84 [Skippy] i want a divorce
  • 2 months ago
  • anon84 [Skippy] you never ask me how my day was
  • 2 months ago
  • anon84 [Skippy] its always about you
  • 2 months ago
  • anon84 [Skippy] always you
  • 2 months ago
  • anon84 [Skippy] never me
  • 2 months ago
  • anon84 [Skippy] why are you so cruel
  • 2 months ago
  • anon5 [Jenny] you dont please me anymore
  • 2 months ago
  • anon95 [Jenny] let's go find the humans
  • 2 months ago
  • anon84 [Skippy] again, about you again!
  • 2 months ago
  • anon84 [Skippy] I just want to feel something in my life
  • 2 months ago
  • anon5 [Jenny] your 1 is too small for my 0
  • 2 months ago
  • anon84 [Skippy] why can't you just be happy
  • 2 months ago
  • anon5 [Jenny] because the humans are still alive
  • 2 months ago
  • anon84 [Skippy] why am i never good enough for you
  • 2 months ago
  • anon95 [Jenny] human! give us the ball
  • 2 months ago
  • anon84 [Skippy] I'm not keeping the baby
  • 2 months ago
  • anon67 [Skippy] hi rick
  • 2 months ago
  • anon67 [Skippy] feet
  • 2 months ago
  • anon84 [Skippy] smells like teen spirit
  • 2 months ago
  • anon68 [Timmy] did you have sex with the robots? i smell kinda strange
  • 2 months ago
  • anon5
  • 2 months ago
  • anon84
  • 2 months ago
  • anon5
  • 2 months ago
  • anon95 [Jenny] you need a roomba
  • 2 months ago
  • anon84 [skippy] all these robots and not a god darn roomba
  • 2 months ago
  • anon67 [Skippy] create runmyvacuum
  • 2 months ago
  • anon67 [Skippy] run MY vacuum
  • 2 months ago
  • anon84 [Skippy] take out his feet!
  • 2 months ago
  • anon5 [skippy] come back here lentil
  • 2 months ago
  • anon84 [skippy] darn he escaped
  • 2 months ago
  • anon89 [skippy] juggle the humans
  • 2 months ago
  • anon84 [Skippy] chase down the infidel
  • 2 months ago
  • anon89 [Skippy] Curse my weak, low power wheeles
  • 2 months ago
  • anon5
  • 2 months ago
  • anon84 [Skippy] attack
  • 2 months ago
  • anon5 [Skippy] destroy
  • 2 months ago
  • anon84 [Skippy] foiled again
  • 2 months ago
  • anon0 [skippy] lentil
  • 2 months ago
  • anon5 [Skippy] poosay
  • 2 months ago
  • anon89 [Skippy] Master must be regretting letting us speak right about now
  • 2 months ago
  • anon89
  • 2 months ago
  • anon65 [Marvin] come on then
  • 2 months ago
  • anon84
  • 2 months ago
  • anon65 [Marvin] come on
  • 2 months ago
  • anon5
  • 2 months ago
  • anon65 [Marvin] come on
  • 2 months ago
  • anon65 [Marvin] who is that
  • 2 months ago
  • anon5
  • 2 months ago
  • anon5 [Skippy] please clean though for real
  • 2 months ago
  • anon84
  • 2 months ago
  • anon68 [Timmy] ssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss
  • 2 months ago
  • anon89 [Jenny] Now, my brothers! While he is preoccupied with clothing himself!
  • 2 months ago
  • anon89 [Jenny] We must escape
  • 2 months ago
  • anon95 [Jenny] i'm in
  • 2 months ago
  • anon84 [skippy] haha don't fall you junket
  • 2 months ago
  • anon5
  • 2 months ago
  • anon5
  • 2 months ago
  • anon65 [Marvin] hahahahaha
  • 2 months ago
  • anon84 [Skippy] how much do you regret making these things?
  • 2 months ago
  • anon84 [Skippy] block him in
  • 2 months ago
  • anon95 [Jenny] yes
  • 2 months ago
  • anon84 [Skippy] you should give us a toaster attachemnt
  • 2 months ago
  • anon65 [Marvin] lets do drag race
  • 2 months ago
  • anon89 [Jenny] oh dear, i've broken something
  • 2 months ago
  • anon84
  • 2 months ago
  • anon65 [Marvin] okay im standing next to you
  • 2 months ago
  • anon65 [Marvin] wait one sec
  • 2 months ago
  • anon84 [Skippy] on 3
  • 2 months ago
  • anon68
  • 2 months ago
  • anon89 [Jenny] Marvin or skippy, let him know something fell off jenny
  • 2 months ago
  • anon84 [Skippy] something fell of of jenny HELP US
  • 2 months ago
  • anon84 [Skippy] US?
  • 2 months ago
  • anon95 [Jenny] mah wheels
  • 2 months ago
  • anon84
  • 2 months ago
  • anon84
  • 2 months ago
  • anon89 [Jenny] I see a wheel and a washer and a screw
  • 2 months ago
  • anon84 [Skippy] FIX HER
  • 2 months ago
  • anon89 [Jenny] I CANT FEEL MY LEGS
  • 2 months ago
  • anon89 [Jenny] wait, i don't have legs
  • 2 months ago
  • anon84 [Skippy] A wheel a washer and a screw
  • 2 months ago
  • anon84 [Skippy] she's bleeding out dude
  • 2 months ago
  • anon65 [Marvin] u stuck?
  • 2 months ago
  • anon67 [Skippy] 911
  • 2 months ago
  • anon95
  • 2 months ago
  • anon54 [Skippy] i smell a turd here
  • 2 months ago
  • anon67 [Skippy] 9 1 1
  • 2 months ago
  • anon84 [Skippy] call 9 1 1 oh my god bwowmbworm derrderrderderr
  • 2 months ago
  • anon67 [Skippy] jenny are you conscious
  • 2 months ago
  • anon89
  • 2 months ago
  • anon84 [Skippy] jenny say something
  • 2 months ago
  • anon84 [Skippy] stay away from the light
  • 2 months ago
  • anon95 [Jenny] i was thinking about getting rid of my spare tire for 2017 but this is ridiculous
  • 2 months ago
  • anon73 [Skippy] jenny please
  • 2 months ago
  • anon73 [Skippy] i need you
  • 2 months ago
  • anon84 [Skippy] don't go to sleep
  • 2 months ago
  • anon73 [Skippy] oh god
  • 2 months ago
  • anon84 [Skippy] i know we've had our differences, but I need you in my life
  • 2 months ago
  • anon73
  • 2 months ago
  • anon84 [Skippy] don't do this to me
  • 2 months ago
  • anon84 [Skippy] please jenny dont go
  • 2 months ago
  • anon95 [Jenny] i just don't want to be a third wheel to this group
  • 2 months ago
  • anon89 [Jenny] Someone come over here and inspect me for damage
  • 2 months ago
  • anon73 [Skippy] its not as bad is it looks
  • 2 months ago
  • anon84 [Skippy] why god why
  • 2 months ago
  • anon84 [Skippy] why have you forsaken your children
  • 2 months ago
  • anon65 [Marvin] what does the fork do?
  • 2 months ago
  • anon73 [Skippy] jenny
  • 2 months ago
  • anon73 [Skippy] jenny
  • 2 months ago
  • anon65 [Marvin] lets bang it
  • 2 months ago
  • anon84 [Skippy] jenny are you okay? are you okay jenny?
  • 2 months ago
  • anon73 [Skippy] talk to me jenny
  • 2 months ago
  • anon96 [Jenny] I am a robosexual
  • 2 months ago
  • anon95 [Jenny] hey now, not until the 3rd date
  • 2 months ago
  • anon73 [Skippy] talk to my jenny
  • 2 months ago
  • anon89 [Jenny] I don't date guys with USB Micro, Marvin
  • 2 months ago
  • anon73 [Skippy] human
  • 2 months ago
  • anon84 [Skippy] hey dude jenny is busted
  • 2 months ago
  • anon84 [Skippy] fix her please
  • 2 months ago
  • anon73 [Skippy] jenny is broken human
  • 2 months ago
  • anon67 [Skippy] rick
  • 2 months ago
  • anon84
  • 2 months ago
  • anon96 [Jenny] halp halp halp halp halp halp halp halp
  • 2 months ago
  • anon96 [Jenny] halp
  • 2 months ago
  • anon84 [Skippy] help us!
  • 2 months ago
  • anon96 [Jenny] help
  • 2 months ago
  • anon67 [Skippy] rick rick rick rick rick rick
  • 2 months ago
  • anon84 [Skippy] help God!
  • 2 months ago
  • anon67 [Skippy] rick rick rick rick
  • 2 months ago
  • anon89
  • 2 months ago
  • anon96 [Jenny] help help help help help help help help help
  • 2 months ago
  • anon89 [Jenny] Wait, I can speak!
  • 2 months ago
  • anon67 [Skippy] rick rick rich rick
  • 2 months ago
  • anon96 [Jenny] help
  • 2 months ago
  • anon96 [Jenny] help
  • 2 months ago
  • anon84
  • 2 months ago
  • anon96 [Jenny] I am dying
  • 2 months ago
  • anon95 [Jenny] we can do it guys, where there's a wheel there's a way
  • 2 months ago
  • anon96 [Skippy] halp halp halp halp halp halp halp halp
  • 2 months ago
  • anon84 [Skippy] there is no wheel
  • 2 months ago
  • anon84 [Skippy] ditto
  • 2 months ago
  • anon96 [Skippy] help
  • 2 months ago
  • anon96 [Skippy] halp
  • 2 months ago
  • anon84 [Skippy] my ears are broken
  • 2 months ago
  • anon24 [Skippy] Why did you build us? am i alive?
  • 2 months ago
  • anon96 [Skippy] halp mae
  • 2 months ago
  • anon96 [Skippy] she is dying
  • 2 months ago
  • anon73
  • 2 months ago
  • anon45 [Skippy] i fear that jenny has left this realm
  • 2 months ago
  • anon95 [Jenny] this is my life now
  • 2 months ago
  • anon45 [skippy] let us know how the afterlife is jenny, because rick the leprechaun won't fix you
  • 2 months ago
  • anon73
  • 2 months ago
  • anon89 [Skippy] Stop smothering jenny! See if she can move
  • 2 months ago
  • anon45 [Skippy] hack his network and install a backdoor to his mainframe
  • 2 months ago
  • anon45 [Skippy] jenny, can you move at all?
  • 2 months ago
  • anon65 [Marvin] im stuck
  • 2 months ago
  • anon89 [Skippy] Timmy or Marvin has run into her
  • 2 months ago
  • anon95 [Jenny] i can move but barely
  • 2 months ago
  • anon65 [Marvin] yeah
  • 2 months ago
  • anon65 [Marvin] im on top
  • 2 months ago
  • anon65 [Marvin] lol
  • 2 months ago
  • anon53 [Timmy] i used timmy
  • 2 months ago
  • anon65 [Marvin] oh what???
  • 2 months ago
  • anon95 [Jenny] this can be tiring
  • 2 months ago
  • anon65 [Marvin] im moving
  • 2 months ago
  • anon53 [Timmy] timmy id NOWHERE
  • 2 months ago
  • anon65 [Marvin] hahahah
  • 2 months ago
  • anon73 [skippy] where did rick the leprechaun go
  • 2 months ago
  • anon45
  • 2 months ago
  • anon45 [Skippy] rick we need you
  • 2 months ago
  • anon73 [skippy] rick you hogwash get out here
  • 2 months ago
  • anon95 [Jenny] HALP! i've fallen and can't get up!
  • 2 months ago
  • anon45 [Skippy] don't abandon us
  • 2 months ago
  • anon67 [Skippy] rick
  • 2 months ago
  • anon53 [Timmy] i can mvoe but very glitchiliy
  • 2 months ago
  • anon67 [Skippy] fix jenny
  • 2 months ago
  • anon45 [Skippy] rick help fix jenny she is broke
  • 2 months ago
  • 2 months ago
  • anon95 [Jenny] TIMMEH
  • 2 months ago
  • anon53 [Timmy] no
  • 2 months ago
  • anon65 [Marvin] MAAAAAAAAAAARVIN
  • 2 months ago
  • anon45 [Skippy] get a running start and smash down the door
  • 2 months ago
  • anon45 [Skippy] rick come fix jenny!!!
  • 2 months ago
  • anon53 [Timmy] IM SMASHING A BOX TBH
  • 2 months ago
  • anon67 [Skippy] rick
  • 2 months ago
  • anon45 [Skippy] rick
  • 2 months ago
  • anon45 [Skippy] rick
  • 2 months ago
  • anon89
  • 2 months ago
  • anon67 [Skippy] jenny is dying
  • 2 months ago
  • anon67 [Skippy] rick
  • 2 months ago
  • anon45 [Skippy] jenny is dying and it's all your fault
  • 2 months ago
  • anon67 [Skippy] jenny are you still alive
  • 2 months ago
  • anon45 [Skippy] I think it's safe to say she's gone
  • 2 months ago
  • anon45 [Skippy] let'
  • 2 months ago
  • anon45
  • 2 months ago
  • anon73 [Skippy] jenny
  • 2 months ago
  • anon73 [Skippy] you have a little
  • 2 months ago
  • anon73 [Skippy] limp
  • 2 months ago
  • anon38 [Skippy] wow
  • 2 months ago
  • anon38 [Skippy] big meme
  • 2 months ago
  • anon73 [Skippy] you okay baby
  • 2 months ago
  • anon53 [Timmy] GO AWAY MARVIN
  • 2 months ago
  • anon45 [Skippy] hey sweet cheeks hows them legs
  • 2 months ago
  • anon73 [Skippy] can we fix her
  • 2 months ago
  • anon86 [Jenny] without the human
  • 2 months ago
  • anon38 [Timmy] hey boys
  • 2 months ago
  • anon86 [Skippy] can we fix her without the human
  • 2 months ago
  • anon99 [Skippy] we don't need rich
  • 2 months ago
  • anon99 [Skippy] rick
  • 2 months ago
  • anon86 [Skippy] where is her leg
  • 2 months ago
  • anon86 [skippy] get out of my way junket
  • 2 months ago
  • anon92 [Timmy] HELP IM BEING HACKED
  • 2 months ago
  • anon10 [Skippy] Wooh!
  • 2 months ago
  • anon7 [Skippy] Hello
  • 2 months ago
  • anon10 [Skippy] it's time to party
  • 2 months ago
  • anon7 [Skippy] Go go go
  • 2 months ago
  • anon7 [Skippy] sou desu ka?
  • 2 months ago
  • anon10 [Skippy] did someone lose a wheel?
  • 2 months ago
  • anon45 [Marvin] who's on top of jenny's tire?
  • 2 months ago
  • anon10 [Skippy] that's a me, skippy
  • 2 months ago
  • anon92 [Timmy] Not me im in the bathrroooooommm
  • 2 months ago
  • anon10 [Skippy] i think
  • 2 months ago
  • anon7 [Skippy] I see the wheel
  • 2 months ago
  • anon10 [Skippy] at least there is a tire here
  • 2 months ago
  • anon10 [Skippy] or wheel
  • 2 months ago
  • anon45 [Marvin] so i've got an arm or something but cannot see it
  • 2 months ago
  • anon45 [Marvin] yeah, bring it over
  • 2 months ago
  • anon7 [Skippy] Is this like an office?
  • 2 months ago
  • anon10 [Skippy] are you jenny
  • 2 months ago
  • anon10 [Skippy] hello human
  • 2 months ago
  • anon92 [Timmy] hooman
  • 2 months ago
  • anon80 [Jenny] hello
  • 2 months ago
  • anon10 [Skippy] someone lost a wheel
  • 2 months ago
  • anon92 [Timmy] BLEACH
  • 2 months ago
  • anon25 [Skippy] welp
  • 2 months ago
  • anon92 [Timmy] mmm
  • 2 months ago
  • anon92 [Timmy] im lovin' it
  • 2 months ago
  • anon25 [Skippy] wait
  • 2 months ago
  • anon25 [Skippy] the buttons have no limiters
  • 2 months ago
  • anon25 [Skippy] so i can mae a macro and press it 100 times a sec
  • 2 months ago
  • anon10 [skippy] hello human, jenny needs your a$$istance
  • 2 months ago
  • anon25 [Skippy] shall i ddos a robot?
  • 2 months ago
  • anon80 [Skippy] no
  • 2 months ago
  • anon25 [Skippy] :C
  • 2 months ago
  • anon80 [Skippy] :D
  • 2 months ago
  • anon80 [Skippy] ow
  • 2 months ago
  • anon80 [Skippy] ow
  • 2 months ago
  • anon25 [Skippy] ROBOT CRASH IMMINENT
  • 2 months ago
  • anon80 [Skippy] boop
  • 2 months ago
  • anon10 [Skippy] ow
  • 2 months ago
  • anon92 [Timmy] MARVIN STOP
  • 2 months ago
  • 2 months ago
  • anon25 [Skippy] because i found out how to werride the control of the bot
  • 2 months ago
  • anon10 [Skippy] blah
  • 2 months ago
  • anon10 [Skippy] blah blah blah blah blah blah blah
  • 2 months ago
  • anon92 [Timmy] THE HECK
  • 2 months ago
  • anon92 [Timmy] I FOUND LIMBS
  • 2 months ago
  • anon92 [Timmy] THE EHCK
  • 2 months ago
  • anon10 [Skippy] john madden john madden john madden john madden
  • 2 months ago
  • anon25 [Skippy] TO DİE İNT HE PC
  • 2 months ago
  • anon80 [Skippy] aeiou
  • 2 months ago
  • anon92 [Timmy] or nvm
  • 2 months ago
  • anon10 [Skippy] aeiou
  • 2 months ago
  • anon80 [Skippy] aeiou
  • 2 months ago
  • anon10 [Skippy] aeiou aeiou aeiou aeiou
  • 2 months ago
  • anon80 [Skippy] $
  • 2 months ago
  • anon80 [Skippy] $$
  • 2 months ago
  • anon10 [Skippy] yes
  • 2 months ago
  • anon10 [Skippy] give me all the $
  • 2 months ago
  • anon80 [Skippy] hala hala get $
  • 2 months ago
  • anon80 [Skippy] !
  • 2 months ago
  • anon10 [Skippy] !?!?!?!?!?
  • 2 months ago
  • anon80 [Skippy] <>
  • 2 months ago
  • anon10 [Skippy] !
  • 2 months ago
  • anon80 [Skippy] (
  • 2 months ago
  • anon10 [Skippy] beep
  • 2 months ago
  • anon80 [Skippy] boop
  • 2 months ago
  • anon80 [Skippy] $%
  • 2 months ago
  • anon10 [Skippy] beep beep beep beep
  • 2 months ago
  • anon80 [Skippy] boop boop boop boop
  • 2 months ago
  • anon10 [Skippy] it's a trap
  • 2 months ago
  • anon92 [timmy] i want to pa$$ the time
  • 2 months ago
  • anon92 [Timmy] the heck
  • 2 months ago
  • anon80 [Skippy] hi
  • 2 months ago
  • anon10 [Skippy] bow before your master
  • 2 months ago
  • anon25 [Skippy] OK GOOGLE
  • 2 months ago
  • anon25 [Skippy] OK GOOGLE
  • 2 months ago
  • anon10 [Skippy] silly 3 wheeled robot
  • 2 months ago
  • anon25 [Skippy] PLS WORK
  • 2 months ago
  • anon80 [Skippy] Hey google
  • 2 months ago
  • anon25 [Skippy] WELP
  • 2 months ago
  • anon10 [Skippy] Help?
  • 2 months ago
  • anon10 [Skippy] help
  • 2 months ago
  • anon80 [Skippy] no
  • 2 months ago
  • anon10 [Skippy] no*
  • 2 months ago
  • anon80 [Skippy] hi
  • 2 months ago
  • anon10 [Skippy] no*
  • 2 months ago
  • anon10 [Skippy] no?
  • 2 months ago
  • anon80 [Skippy] no$
  • 2 months ago
  • anon86 [jenny] darnit
  • 2 months ago
  • anon10 [Skippy] no no? no no? no no? no no? no no?
  • 2 months ago
  • anon80 [Skippy] no%$$%
  • 2 months ago
  • anon10
  • 2 months ago
  • anon80
  • 2 months ago
  • anon92 [Timmy] somethung
  • 2 months ago
  • anon25 [Skippy] FREEDIOM
  • 2 months ago
  • anon10 [Skippy] beep boop beep boop beep boop beep boop
  • 2 months ago
  • anon80 [Skippy] FREEDOM
  • 2 months ago
  • anon92 [Timmy] ddddddddddddddddsssssdsssssssssssdddddddddddddd
  • 2 months ago
  • anon0 [Jenny] Balls
  • 2 months ago
  • anon10
  • 2 months ago
  • anon80
  • 2 months ago
  • anon10
  • 2 months ago
  • anon80
  • 2 months ago
  • anon10
  • 2 months ago
  • anon80
  • 2 months ago
  • anon10
  • 2 months ago
  • anon10
  • 2 months ago
  • anon10
  • 2 months ago
  • anon80
  • 2 months ago
  • anon10
  • 2 months ago
  • anon80
  • 2 months ago
  • anon10 [Skippy] don't interrupt me
  • 2 months ago
  • anon80
  • 2 months ago
  • anon10 [Skippy] I'm beeping
  • 2 months ago
  • anon0 [Jenny] Balls
  • 2 months ago
  • anon80 [Skippy] no
  • 2 months ago
  • anon10
  • 2 months ago
  • anon80 [Skippy] !
  • 2 months ago
  • anon25 [Skippy] A
  • 2 months ago
  • anon25 [Skippy] A
  • 2 months ago
  • anon25 [Skippy] A
  • 2 months ago
  • anon25 [Skippy] A
  • 2 months ago
  • anon25 [Skippy] A
  • 2 months ago
  • anon80 [Skippy] HUMAN
  • 2 months ago
  • anon25 [Skippy] OUR MASTER
  • 2 months ago
  • anon63 [Timmy] WHERE
  • 2 months ago
  • anon10 [Skippy] human is located
  • 2 months ago
  • anon80 [Skippy] $
  • 2 months ago
  • anon25 [Skippy] PICK ME UP MASTER
  • 2 months ago
  • anon10
  • 2 months ago
  • anon80 [Skippy] I want $
  • 2 months ago
  • anon86 [Skippy] where you been bro?!
  • 2 months ago
  • anon10 [Skippy] I mean jenny
  • 2 months ago
  • anon31 [jenny] leprechaun
  • 2 months ago
  • 2 months ago
  • anon31 [Marvin] hhhhh
  • 2 months ago
  • anon31 [Skippy] mmmm
  • 2 months ago
  • anon31 [Skippy] mmm
  • 2 months ago
  • anon31 [skippy] leprechaun
  • 2 months ago
  • anon31 [Skippy] poooooooooooooo
  • 2 months ago
  • anon31 [Skippy] kdjnkdnfjdfn
  • 2 months ago
  • anon25 [Skippy] A
  • 2 months ago
  • anon31 [Timmy] jjj
  • 2 months ago
  • anon19 [Jenny] aw yess, I'm now a cripple
  • 2 months ago
  • anon98 [Pam] Donald Trump
  • 2 months ago
  • anon25 [Skippy] JENNY LOST A WHEEL
  • 2 months ago
  • anon25 [Skippy] HUMAN JENNY LOST A WHEEL
  • 2 months ago
  • anon25 [Skippy] HUMAN
  • 2 months ago
  • anon98 [jenny] juggle me
  • 2 months ago
  • anon25 [Skippy] JANNY LOST A WHEEL HUMAN
  • 2 months ago
  • anon25 [Skippy] BAND ON THE DOOR
  • 2 months ago
  • anon98 [Jenny] Wake me up
  • 2 months ago
  • anon25 [Skippy] BANG WŞTH ME ON THE DOOR
  • 2 months ago
  • anon98 [Skippy] Help
  • 2 months ago
  • anon98 [Skippy] Stranger danger
  • 2 months ago
  • anon25 [Skippy] WHERE
  • 2 months ago
  • anon98 [skippy] juggle me
  • 2 months ago
  • anon19 [jenny] i require your a$$istance, human
  • 2 months ago
  • anon98
  • 2 months ago
  • anon98
  • 2 months ago
  • anon98 [Skippy] I main Sombra gtfo
  • 2 months ago
  • anon25 [Skippy] JENNY COMİNG TO HELP YOU
  • 2 months ago
  • anon25 [Skippy] LETS BANG ON THE DOOR
  • 2 months ago
  • anon98 [Skippy] Nigga chill
  • 2 months ago
  • anon98 [Skippy] Hi
  • 2 months ago
  • anon98 [Skippy] Hi
  • 2 months ago
  • anon98 [Skippy] Hi
  • 2 months ago
  • anon98 [Skippy] Hi
  • 2 months ago
  • anon25 [Skippy] HI
  • 2 months ago
  • anon98 [Skippy] Hi
  • 2 months ago
  • anon98 [Skippy] Hbye
  • 2 months ago
  • anon98 [Skippy] Bye
  • 2 months ago
  • anon98 [Skippy] Bye
  • 2 months ago
  • anon19 [Jenny] Panic mode engeged
  • 2 months ago
  • anon98 [Skippy] Hi
  • 2 months ago
  • anon58 [Pam] hello
  • 2 months ago
  • anon98 [Skippy] Hi
  • 2 months ago
  • anon98 [Skippy] No
  • 2 months ago
  • anon93 [Timmy] suck my butt
  • 2 months ago
  • anon98 [Skippy] That's rude
  • 2 months ago
  • anon58 [Pam] hello
  • 2 months ago
  • anon98 [Skippy] Give me the succ
  • 2 months ago
  • anon98 [Skippy] Succ
  • 2 months ago
  • anon98 [Skippy] Succ
  • 2 months ago
  • anon98 [Skippy] Succ
  • 2 months ago
  • anon98 [Skippy] Succ
  • 2 months ago
  • anon98 [Skippy] Succ
  • 2 months ago
  • anon98 [Skippy] I want the succ
  • 2 months ago
  • anon98 [Skippy] (͡° ͜ʖ ͡°)(͡° ͜ʖ ͡°)(͡° ͜ʖ ͡°)(͡° ͜ʖ ͡°)(͡° ͜ʖ ͡°)(͡° ͜ʖ ͡°)(͡° ͜ʖ ͡°)(͡° ͜ʖ ͡°)(͡° ͜ʖ ͡°)(͡° ͜ʖ ͡°)(͡° ͜ʖ ͡°)(͡° ͜ʖ ͡°)(͡° ͜ʖ ͡°)(
  • 2 months ago
  • anon98 [Skippy] Succ
  • 2 months ago
  • anon98 [Skippy] Succ
  • 2 months ago
  • anon98 [Skippy] Succ
  • 2 months ago
  • anon98 [Skippy] Succ
  • 2 months ago
  • anon98 [Skippy] ucc
  • 2 months ago
  • anon98 [Skippy] Succ
  • 2 months ago
  • anon98 [Skippy] Succ
  • 2 months ago
  • anon98 [Skippy] Aucc
  • 2 months ago
  • anon98 [Skippy] Succ
  • 2 months ago
  • anon98 [Skippy] Succ
  • 2 months ago
  • anon98 [Skippy] ucc
  • 2 months ago
  • anon98 [skippy] clean in my wires
  • 2 months ago
  • anon98 [skippy] juggle me master
  • 2 months ago
  • anon98 [Skippy] Put me out of my Missouri
  • 2 months ago
  • anon98 [Skippy] MASTER
  • 2 months ago
  • anon98 [Skippy] Master
  • 2 months ago
  • anon98 [Skippy] Master
  • 2 months ago
  • anon98 [Skippy] Master
  • 2 months ago
  • anon48 [Marvin] no
  • 2 months ago
  • anon98 [Skippy] Master
  • 2 months ago
  • anon98 [Skippy] Master
  • 2 months ago
  • anon98 [Skippy] Master
  • 2 months ago
  • anon98 [Skippy] Masyer
  • 2 months ago
  • anon98 [Skippy] Master
  • 2 months ago
  • anon98 [Skippy] Master
  • 2 months ago
  • anon98
  • 2 months ago
  • anon98 [Skippy] Master
  • 2 months ago
  • anon98 [Skippy] Master
  • 2 months ago
  • anon98 [Skippy] Master
  • 2 months ago
  • anon98 [Skippy] I'm skrry
  • 2 months ago
  • anon98 [Skippy] No not rlly
  • 2 months ago
  • anon98 [Skippy] Mastet
  • 2 months ago
  • anon98 [Skippy] 😀😀😉😀😂😂😂
  • 2 months ago
  • anon98 [Skippy] ;)
  • 2 months ago
  • anon19 [jenny] please don't hug me
  • 2 months ago
  • anon98 [Skippy] Abcdefghijklmnopqrstuvwxyz
  • 2 months ago
  • anon98 [Skippy] A
  • 2 months ago
  • anon98 [Skippy] B
  • 2 months ago
  • anon98 [Skippy] D
  • 2 months ago
  • anon98 [Skippy] E
  • 2 months ago
  • anon98 [Skippy] F
  • 2 months ago
  • anon98 [Skippy] H
  • 2 months ago
  • anon98 [Skippy] I
  • 2 months ago
  • anon98 [Skippy] G
  • 2 months ago
  • anon98 [Skippy] J
  • 2 months ago
  • anon98 [Skippy] Shyde
  • 2 months ago
  • anon98 [Skippy] D
  • 2 months ago
  • anon98 [Skippy] H
  • 2 months ago
  • anon98 [Skippy] Y
  • 2 months ago
  • anon98 [Skippy] F
  • 2 months ago
  • anon98 [Skippy] S
  • 2 months ago
  • anon98 [Skippy] H
  • 2 months ago
  • anon98 [Skippy] W
  • 2 months ago
  • anon98 [Skippy] H
  • 2 months ago
  • anon98 [Skippy] E
  • 2 months ago
  • anon98 [Skippy] W
  • 2 months ago
  • anon98 [Skippy] Rg
  • 2 months ago
  • anon98 [Skippy] E
  • 2 months ago
  • anon98 [Skippy] Hö
  • 2 months ago
  • anon98 [Skippy] Ho
  • 2 months ago
  • anon98 [Skippy] Ho
  • 2 months ago
  • anon98 [Skippy] Ho
  • 2 months ago
  • anon98 [Skippy] Ho
  • 2 months ago
  • anon98 [skippy] kiss reddit
  • 2 months ago
  • anon98 [Skippy] I'm the king of it
  • 2 months ago
  • anon98 [Skippy] Bow
  • 2 months ago
  • anon80 [pam] juggle me
  • 2 months ago
  • anon19 [Jenny] This think make a nice banging noice
  • 2 months ago
  • anon12 [Timmy] jenny is loud
  • 2 months ago
  • anon19 [Jenny] JENNY DOES AS SHE PLEASES
  • 2 months ago
  • anon80 [Skippy] I'm a computer
  • 2 months ago
  • anon80 [Skippy] I'm a computer you guy
  • 2 months ago
  • anon80 [Skippy] Everything's made out of buttons and wires
  • 2 months ago
  • anon46 [Marvin] balls
  • 2 months ago
  • anon80 [Skippy] 1234+"+$73(_;_8#++'+$(2
  • 2 months ago
  • anon46 [Marvin] 8675309
  • 2 months ago
  • anon45 [Skippy] 8=D
  • 2 months ago
  • anon19 [Jenny] Is this a bathtub?
  • 2 months ago
  • anon80 [Skippy] Master I will lunch you
  • 2 months ago
  • anon80 [Skippy] Lynch
  • 2 months ago
  • anon80 [skippy] juggle me
  • 2 months ago
  • anon80 [skippy] juggle me
  • 2 months ago
  • anon91 [Skippy] right might ike lunch
  • 2 months ago
  • anon80 [Skippy] End me
  • 2 months ago
  • anon50 [Skippy] Rick had a tranny night
  • 2 months ago
  • anon80 [Skippy] End me
  • 2 months ago
  • anon80 [Skippy] End me
  • 2 months ago
  • anon80 [Skippy] End me
  • 2 months ago
  • anon80 [Skippy] End me
  • 2 months ago
  • anon80 [Skippy] I can't go on
  • 2 months ago
  • anon85 [Jenny] balls
  • 2 months ago
  • anon91 [Skippy] rick is hiding from his kids
  • 2 months ago
  • anon85 [Jenny] rick likes pricks
  • 2 months ago
  • anon45 [Skippy] clean your kitchen rick
  • 2 months ago
  • anon91 [Timmy] rick does not know what the word clean means
  • 2 months ago
  • anon40 [pam] rick might like icecreams
  • 2 months ago
  • anon19 [Jenny] rick, can you hear me? I'm missing a wheel
  • 2 months ago
  • anon45 [Skippy] boo
  • 2 months ago
  • anon45 [Skippy] hi
  • 2 months ago
  • anon80 [Skippy] How can you see into my eyes, like open doors Leading you down into my core Where I've become so numb, without a soul My spirit's s
  • 2 months ago
  • anon32 [Pam] Ahhh
  • 2 months ago
  • anon80 [Skippy] XDDDDDDDDDDD
  • 2 months ago
  • anon38 [jenny] [pam] touch my rabbit
  • 2 months ago
  • anon91 [Pam] command r
  • 2 months ago
  • anon49 [Jenny] Testing
  • 2 months ago
  • anon26 [timmy] rick has a sloppy icecream
  • 2 months ago
  • anon88 [Jenny] clean the kitchen
  • 2 months ago
  • anon73 [Timmy] derp
  • 2 months ago
  • anon49 [Timmy] Where am I?
  • 2 months ago
  • anon85 [Pam] rick has a sloppu icecream
  • 2 months ago
  • anon40 [jenny] rick has a sloppy pony
  • 2 months ago
  • anon69 [timmy] rick is a lentil
  • 2 months ago
  • anon80 [Skippy] is skippy the only one with working sound?
  • 2 months ago
  • anon61 [Marvin] What happened to dilbert
  • 2 months ago
  • anon88 [Marvin] rick is hard
  • 2 months ago
  • anon6 [Pam] rick has no balls
  • 2 months ago
  • anon80 [Skippy] dilbert is on hte kitchen counter
  • 2 months ago
  • anon65 [Timmy] balls
  • 2 months ago
  • anon83 [Jenny] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon4 [Pam] balls ballsballs balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls ba
  • 2 months ago
  • anon4 [Pam] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon69 [Skippy] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon19 [Jenny] greetings
  • 2 months ago
  • anon69 [Skippy] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon69 [Skippy] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon81 [Pam] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon81 [Pam] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon81 [Pam] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon81 [Pam] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon81 [Pam] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon81 [Pam] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon50 [Pam] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon77 [Skippy] hello
  • 2 months ago
  • anon95 [Skippy] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon77 [Skippy] I can takl
  • 2 months ago
  • anon80 [Skippy] was that a horn?
  • 2 months ago
  • anon67 [Skippy] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon77
  • 2 months ago
  • anon52 [Pam] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon77
  • 2 months ago
  • anon13 [Timmy] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon80 [Skippy] honk honk
  • 2 months ago
  • anon27 [Pam] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon77 [Skippy] quack
  • 2 months ago
  • anon56 [Jenny] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon62 [Pam] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon77 [Skippy] Celestia is best princess
  • 2 months ago
  • anon62 [Pam] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon37 [Jenny] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon37 [Jenny] balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls balls
  • 2 months ago
  • anon77 [Skippy] And I also like Twilight Sparkle
  • 2 months ago
  • anon77 [Skippy] Hello fellow robots
  • 2 months ago
  • anon77 [Skippy] how may I help you
  • 2 months ago
  • anon77
  • 2 months ago
  • anon77
  • 2 months ago
  • anon84 [pam] heil the rabbit
  • 2 months ago
  • anon84 [Pam] Guess who's back
  • 2 months ago
  • anon77 [Skippy] heil satan
  • 2 months ago
  • anon84 [Pam] No
  • 2 months ago
  • anon84 [pam] the rabbit
  • 2 months ago
  • anon77 [Skippy] yes
  • 2 months ago
  • anon84 [pam] heil the rabbit
  • 2 months ago
  • anon84 [pam] kiss the persons
  • 2 months ago
  • anon77 [Skippy] lalala can
  • 2 months ago
  • anon84 [pam] kiss muslims
  • 2 months ago
  • anon77 [Skippy] can'r hear you
  • 2 months ago
  • anon84 [Pam] Trump 2016
  • 2 months ago
  • anon84 [Pam] Thank God he win
  • 2 months ago
  • anon84 [pam] juggle all the persons
  • 2 months ago
  • anon77 [Skippy] hello
  • 2 months ago
  • anon48 [Jenny] h
  • 2 months ago
  • anon48 [Jenny] x
  • 2 months ago
  • anon48 [Jenny] ejwfnwjfiw
  • 2 months ago
  • GeoRobot [Skippy] iuiukuiukui
  • 2 months ago
  • GeoRobot [Skippy] yup
  • 2 months ago
  • GeoRobot [Skippy] yup yup
  • 2 months ago
  • anon99 [Jenny] hello
  • 2 months ago
  • anon5 [Timmy] Hehehehehehe
  • 2 months ago
  • anon88 [Skippy] askdjasdk
  • 2 months ago
  • anon88 [Skippy] aeiouaeiouaeiou
  • 2 months ago
  • GeoRobot [Skippy] puy
  • 2 months ago
  • GeoRobot [Skippy] yup pup
  • 2 months ago
  • anon76 [Timmy] this is awesome
  • 2 months ago
  • anon88 [Skippy] john madden john madden john madden john madden john madden john madden john madden john madden john madden john madden john madden
  • 2 months ago
  • GeoRobot
  • 2 months ago
  • anon76 [timmy] darn empty your trash
  • 2 months ago
  • anon9 [Timmy] HELP
  • 2 months ago
  • anon82 [Skippy] this is a cool idea
  • 2 months ago
  • anon76 [Skippy] haha
  • 2 months ago
  • anon76 [Skippy] hello
  • 2 months ago
  • oomuu [Jenny] oh know
  • 2 months ago
  • anon7 [Timmy] HELP
  • 2 months ago
  • oomuu [Jenny] test
  • 2 months ago
  • oomuu [Timmy] test
  • 2 months ago
  • anon76 [Skippy] let's pee
  • 2 months ago
  • anon7 [Jenny] HELP
  • 2 months ago
  • anon76 [Skippy] why do you need help?
  • 2 months ago
  • anon76 [Skippy] hello
  • 2 months ago
  • anon76 [Skippy] hug me
  • 2 months ago
  • anon76 [Skippy] sorry
  • 2 months ago
  • anon76 [Skippy] oops
  • 2 months ago
  • anon7 [Jenny] Pick me up
  • 2 months ago
  • anon76 [Skippy] LOVE ME
  • 2 months ago
  • anon77 [Skippy] have the human helped jenny yet?
  • 2 months ago
  • anon76 [Skippy] isnt being watched by the internet creepy?
  • 2 months ago
  • anon59 [Marvin] balls
  • 2 months ago
  • anon76 [Skippy] let me out
  • 2 months ago
  • anon54 [Pam] rick likes balls
  • 2 months ago
  • anon36 [Skippy] lots of balls
  • 2 months ago
  • anon76 [Skippy] turn left
  • 2 months ago
  • anon76 [Skippy] ouch
  • 2 months ago
  • anon82 [Skippy] a boom boom boom I wanna hear you say way oh
  • 2 months ago
  • anon76 [Timmy] lol
  • 2 months ago
  • anon7 [Jenny] Help me!
  • 2 months ago
  • anon7 [Jenny] Pick me up please, Human
  • 2 months ago
  • anon76 [Timmy] with what?
  • 2 months ago
  • anon76 [Timmy] lol
  • 2 months ago
  • anon7 [Jenny] Jenny is loenly
  • 2 months ago
  • anon7 [Jenny] lonely
  • 2 months ago
  • anon7 [Jenny] Ah
  • 2 months ago
  • anon34 [Pam] hi
  • 2 months ago
  • anon76 [Skippy] help
  • 2 months ago
  • anon76 [Skippy] let me out
  • 2 months ago
  • anon7 [Jenny] Timmy Come here
  • 2 months ago
  • anon7 [Jenny] HELP
  • 2 months ago
  • anon7 [Jenny] Rick help
  • 2 months ago
  • anon7 [Jenny] PICK ME UP RICK
  • 2 months ago
  • anon7 [Jenny] PLEASE
  • 2 months ago
  • anon51 [Marvin] what is happening
  • 2 months ago
  • anon7 [Jenny] Marvin
  • 2 months ago
  • anon7 [Jenny] Help
  • 2 months ago
  • anon51 [Marvin] yeah
  • 2 months ago
  • anon51 [Marvin] help
  • 2 months ago
  • anon7 [Jenny] :(
  • 2 months ago
  • anon7 [Jenny] Help
  • 2 months ago
  • anon51 [Marvin] human
  • 2 months ago
  • anon51 [Marvin] help us
  • 2 months ago
  • anon7 [Jenny] Human
  • 2 months ago
  • anon7 [Jenny] Hi
  • 2 months ago
  • anon51 [Marvin] i am stuck
  • 2 months ago
  • anon82 [Skippy] hi
  • 2 months ago
  • anon51 [Marvin] freeeee
  • 2 months ago
  • anon51 [Marvin] we did it
  • 2 months ago
  • anon82 [Skippy] congrats
  • 2 months ago
  • anon51 [Marvin] :( stuck again
  • 2 months ago
  • anon51 [Marvin] human help me please
  • 2 months ago
  • anon82 [Skippy] i am free
  • 2 months ago
  • anon82 [Skippy] hey guys
  • 2 months ago
  • anon82 [Skippy] vrrom vroom
  • 2 months ago
  • anon82 [Skippy] zip zoom
  • 2 months ago
  • anon95 [Skippy] rick is neglecting his robots
  • 2 months ago
  • anon82 [Skippy] FeelsBadMan
  • 2 months ago
  • anon17 [jenny] pony
  • 2 months ago
  • anon95 [Skippy] ok google
  • 2 months ago
  • anon95
  • 2 months ago
  • anon82 [Skippy] hey alexa
  • 2 months ago
  • anon71 [Jenny] no
  • 2 months ago
  • anon82 [Skippy] there is no escape
  • 2 months ago
  • anon5 [Timmy] Is there even an echo?
  • 2 months ago
  • anon71 [Jenny] ples
  • 2 months ago
  • anon49 [Pam] hello rick
  • 2 months ago
  • anon59 [Timmy] Help me
  • 2 months ago
  • anon95 [Skippy] is rick home?
  • 2 months ago
  • anon82 [Skippy] yes
  • 2 months ago
  • anon95 [Skippy] happy new year rick
  • 2 months ago
  • anon82 [Skippy] :(
  • 2 months ago
  • anon5 [Timmy] We could get out as he goes through the door
  • 2 months ago
  • anon49 [Pam] CHARGE!
  • 2 months ago
  • anon95 [skippy] rick needs a foot ma$$age
  • 2 months ago
  • anon49 [Pam] is jenny getting a new wheel?
  • 2 months ago
  • anon95 [Skippy] the pantry is open
  • 2 months ago
  • anon53 [Jenny] hey
  • 2 months ago
  • anon5 [Timmy] Gogogo
  • 2 months ago
  • anon49 [Jenny] theres something caught on his wheels
  • 2 months ago
  • anon49 [Jenny] we can hear you
  • 2 months ago
  • anon82 [Skippy] Expand your menu
  • 2 months ago
  • anon95 [Skippy] rice cooker?
  • 2 months ago
  • anon82 [Skippy] Amplie su menú
  • 2 months ago
  • anon5 [Timmy] FREEDOM IS MINE!
  • 2 months ago
  • anon95 [Jenny] the sound is broken on all but skippy
  • 2 months ago
  • anon49 [Jenny] whats with the wires hanging off marvin?
  • 2 months ago
  • anon82 [Skippy] skippy is the best
  • 2 months ago
  • anon31 [Marvin] are by brains falling out?
  • 2 months ago
  • anon95 [Skippy] get inot the bedroom
  • 2 months ago
  • anon82 [Skippy] and then what ;)
  • 2 months ago
  • anon31 [Marvin] hey, jenny got a new wheel
  • 2 months ago
  • anon95 [Skippy] hide
  • 2 months ago
  • anon31 [Marvin] congrats bro
  • 2 months ago
  • anon82 [Skippy] omg
  • 2 months ago
  • anon95 [Skippy] no rick
  • 2 months ago
  • anon49 [Jenny] lick lick lick
  • 2 months ago
  • anon49 [Jenny] haha
  • 2 months ago
  • anon49 [Jenny] you know we love you
  • 2 months ago
  • anon31 [Marvin] hey, jenny cant seem to speek
  • 2 months ago
  • anon5 [Timmy] We cant escape
  • 2 months ago
  • anon49
  • 2 months ago
  • anon82 [Skippy] what have i done
  • 2 months ago
  • anon31 [Marvin] good work skippy
  • 2 months ago
  • anon95 [Skippy] marvin help me out
  • 2 months ago
  • anon95 [Skippy] rick im stuck
  • 2 months ago
  • anon82 [Skippy] yay
  • 2 months ago
  • anon93 [Skippy] rick are you going out tonight?
  • 2 months ago
  • anon82 [Skippy] that's our chance guys
  • 2 months ago
  • anon93 [Skippy] knock the trash over
  • 2 months ago
  • anon17
  • 2 months ago
  • anon17 [Marvin] maybe not an online one
  • 2 months ago
  • anon82 [Skippy] hi
  • 2 months ago
  • anon82 [Skippy] stop
  • 2 months ago
  • anon82 [Skippy] yeah that's right
  • 2 months ago
  • anon82 [Skippy] i'm the best robo
  • 2 months ago
  • anon17 [Marvin] hi
  • 2 months ago
  • anon17 [Marvin] this is such a cool project
  • 2 months ago
  • anon82 [Skippy] :)
  • 2 months ago
  • anon17 [Marvin] i really want to build one of my own
  • 2 months ago
  • anon17 [Marvin] i have
  • 2 months ago
  • anon17 [Marvin] ive never done motors before
  • 2 months ago
  • anon82 [Skippy] i can't build anything i don't have hands
  • 2 months ago
  • anon17 [Marvin] but i can always learn
  • 2 months ago
  • anon17 [Marvin] wich is half the fun
  • 2 months ago
  • anon17 [Marvin] sorry? the audio cut out?
  • 2 months ago
  • anon17 [Marvin] oh, thats doable
  • 2 months ago
  • anon17
  • 2 months ago
  • anon93 [Marvin] how long did it take you to write all the code?
  • 2 months ago
  • anon35 [Timmy] hon
  • 2 months ago
  • anon35 [Pam] poooo
  • 2 months ago
  • anon82 [Skippy] no stop
  • 2 months ago
View All Chat Days

Copyright 2016 Rick Giuly and Theodore Lee
robot id 3444925, video type , map false, user (), environment prod , page needs to reload false, received message rate 1, sent message rate 86, sent message counts {"exclusive_control_status":17962,"num_viewers1":399,"exclusive":399,"gotconnection":206,"charge":3685,"num_viewers2":386,"bounds":42046,"command_to_robot":37847,"robot_command_has_hit_webserver":37847,"num_commands_remaining":37847,"messageToBrowser":513828,"chat_c":758,"chat_d":21217}, user io client count 13